Novel method for isothermal amplification detection of double-stranded nucleic acid based on nicking enzyme

A double-stranded nucleic acid, nicking endonuclease technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of complex reaction system, non-specific amplification, replacement of primers to reduce amplification efficiency, etc. Achieve the effect of efficient amplification reaction, simplified operation, and short reaction time.

Active Publication Date: 2015-06-24
QINGDAO NAVID BIOTECH CO LTD
View PDF4 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In order to improve the shortcomings of the technologies described in patents US2008096257A1 and US2009092967A1, such as complex reaction systems that easily cause non-specific amplification, replacement primers occupying templates to block amplification and reduce amplification efficiency, the present invention provides a simple and efficient nucleic acid isothermal Amplification detection method, this method can realize high-efficiency and specific amplification of target nucleic acid with only three primers, and the system is simple; the design of the amplification primer P2 and the single-stranded template annealing region next to the cutting point makes the reaction have better specificity, and The 3' end of the template is completely complementary to the primer, so that the amplified template can be efficiently used by the primer, and the reaction efficiency is higher; different nicking endonucleases can be selected according to the reaction temperature, and the applicable temperature range is wide, which is suitable for on-site rapid detection needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel method for isothermal amplification detection of double-stranded nucleic acid based on nicking enzyme
  • Novel method for isothermal amplification detection of double-stranded nucleic acid based on nicking enzyme
  • Novel method for isothermal amplification detection of double-stranded nucleic acid based on nicking enzyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Embodiment 1: Verify the feasibility of the method and the correctness of its principle. In this example, PBS plasmid is used as the target nucleic acid, three primers are used for constant temperature detection of exponential amplification, and the feasibility of the method and the correctness of the principle are verified by fluorescent signals. To the isothermal amplification system, 1 μL of target E. coli PBS plasmids of different concentrations (ie, SEQ ID NO.1 containing the amplified sequence of 5'-CATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATC-3') and 1 μL of double distilled water were added as a negative control group, 10×Thermpol (200mM Tris-HCl, 100mM KCl, 100mM (NH 4 ) 2 SO 4 , 20 mM MgSO 4 , 1% Triton X-100pH8.8@25℃) 1μL, 0.1μL Bst DNA polymerase, large fragment, 0.5μL Nt.BsrDI nicking endonuclease, 0.6μL (2.5mM) dNTPs, 1μL (8×10 -6 M) PBS amplification primer PBS-P1 (that is, the sequence of SEQ ID NO.2 is 5'-CGCTACCCATACATAC...

Embodiment 2

[0065] Embodiment 2: the specificity of verification method

[0066] 100zmol of the target Escherichia coli PBS plasmid added to the isothermal amplification system (i.e., SEQ ID NO. 1 contains the amplified sequence of 5'-CATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATC-3"), and then added different amounts of Escherichia coli genome (respectively 0zmol , 10zmol, 100zmol, 1amol), 10×Thermpol (200mM Tris-HCl, 100mM KCl, 100mM (NH 4 ) 2 SO 4 , 20 mM MgSO 4 , 1% Triton X-100pH8.8@25℃) 1μL, 0.1μL Bst DNA polymerase, large fragment, 0.5μL Nt.BsrDI nicking endonuclease, 0.6μL (2.5mM) dNTPs, 1μL (8×10 -6 M) PBS amplification primer PBS-P1 (that is, the sequence of SEQ ID NO.2 is 5'-CGCTACCCATACATACTGTTCCATTGGCCCATACCAAACGACGAG-3'), 1 μL (3×10 -7 M) PBS replacement primer PBS-B1 (that is, the sequence of SEQ ID NO.3 is 5'-GGAACCGGAGCTGAATG-3'), 1 μL (8×10 -6 M) PBS amplification primer PBS-P2 (that is, the sequence of SEQ ID NO.4 is 5'-CGCTACGGTTCTATAGTGT...

Embodiment 3

[0067] Embodiment 3: Using this method to detect Vibrio parahaemolyticus

[0068] After measuring the concentration of the extracted Vibrio parahaemolyticus genomic DNA, perform gradient dilution, and add different concentrations of Vibrio parahaemolyticus genomic DNA (that is, SEQ ID NO.5 contains the amplified sequence of 5 '-ACATTGCGTATTTTCGCAGGTCAAAAATGATCCAACAGACATCTGCAAATAAAGGAGGCCAGCATGAAGATTAAAGTAGCATCTGCGGTTTTGGCCGT ATCTA-3") 1 μL and as a negative control group, add 1 μL of double distilled water, 10×Thermpol (200mM Tris-HCl, 100mM KCl, 100mM (NH 4 ) 2 SO 4 , 20 mM MgSO 4 , 1% Triton X-100pH8.8@25℃) 1μL, 0.1μL Bst DNA polymerase, large fragment, 0.5μL Nt.BsrDI nicking endonuclease, 0.6μL (2.5mM) dNTPs, 1μL (8×10 -6 M) Vibrio parahaemolyticus amplification primer VP-P1 (that is, the sequence of SEQ ID NO.6 is 5'-ATCACGTCAGTCTACTCGTAGCATTGCCCTTTATTTGCAGATGTCTGTTG-3'), 1 μL (3×10 -7 M) Vibrio parahaemolyticus replacement primer VP-B1 (that is, the sequence of SEQ ID...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel method for isothermal amplification detection of a double-stranded nucleic acid based on nicking enzyme, belongs to the field of nucleic acid test, and in particular to a method for amplifying a single-chain target from a double-stranded nucleic acid target under the combined action of the nicking incision enzyme and polymerase and carrying out efficient specificity amplification on the target nucleic acid employing two amplification products and a replacement primer in an isothermal condition. Through selection of one amplification primer and an amplification template annealing region, efficient specificity amplification of the target nucleic acid can be finished by only three primers; the 3' end of the template is completely complementary with the primer; the specificity is improved; meanwhile, the problem of refractory amplification due to the fact that the replacement primer occupies the complementary position of the amplification primer in the prior art is avoided; the amplification primer can also be designed into a form of a molecular beacon; and only correctly amplified target sequence can be annealed together with the primer in the form, and generates subsequent fluorescence signals, so that the method has relatively good specificity.

Description

technical field [0001] The invention relates to nucleic acid isothermal amplification and detection technology, and belongs to the field of nucleic acid detection. More specifically, it relates to a method for efficiently and specifically amplifying a target nucleic acid under isothermal conditions by using two amplification primers and one displacement primer under the joint action of a nicking endonuclease and a polymerase. [0002] The invention also relates to the application in the detection of pathogenic microorganism nucleic acid. Background technique [0003] In recent decades, with the invention and application of the polymerase chain reaction (Polymerase Chain Reaction, PCR), the development of double-stranded nucleic acid in vitro amplification and in vitro detection has been greatly promoted. Because of its high sensitivity and good specificity, it has been widely used in the field of nucleic acid amplification and molecular detection, and is currently the most ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor石超马翠萍刘琦赵海杰
OwnerQINGDAO NAVID BIOTECH CO LTD