Supercharge Your Innovation With Domain-Expert AI Agents!

Primer and probe for detecting methylation levels of BMP3 and NDRG4 in biological sample

A biological sample, methylation technology, applied in the field of biotechnology and diagnostic research, can solve the problems of long processing cycle, physical trauma and high cost

Inactive Publication Date: 2015-10-14
HANGZHOU NEW HORIZON HEALTH TECH CO LTD
View PDF1 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are mainly the following types of screening: (1) routine blood tests, which have low specificity and sensitivity and are traumatic to the body; (2) imaging studies, such as colonoscopy, flexible sigmoidoscopy, and CT colonography (virtual colonoscopy), double-contrast barium enema (DCBE), etc. These methods require pre-examination drug bowel cleansing, anesthesia, etc., which are relatively traumatic to the body; (3) Fecal occult blood detection, such as fecal occult blood test ( FOBT), fecal immunochemical test (FIT), etc., which are convenient and non-invasive but have low specificity and sensitivity
At the same time, the above methods all need to be implemented in the hospital, the treatment period is long, or the cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe for detecting methylation levels of BMP3 and NDRG4 in biological sample
  • Primer and probe for detecting methylation levels of BMP3 and NDRG4 in biological sample
  • Primer and probe for detecting methylation levels of BMP3 and NDRG4 in biological sample

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0203] PCR reactions were performed using the following items.

[0204] (1) Sample preparation

[0205] Extract DNA from the collected stool samples in the laboratory, take 20-50ul (2-10μg) DNA, add 1 / 10 volume of 3M NaOH (0.3M final concentration, freshly prepared), and incubate in a metal bath at 37-42°C for 20min; add 5 - 10 times the volume of DNA solution with sulfite conversion solution, mix well, and incubate in a metal bath at 50-55°C in the dark for 16 hours; the modified DNA is purified and recovered using a DNA purification column, and 90% ethanol with 0.2-0.3M NaOH is used in the middle Solution for desulfurization; dissolve in 20-40ul H2O and set aside.

[0206] (2) PCR reaction

[0207] According to the PCR reaction system in Table 1, use the following primers and probes to perform fluorescent quantitative PCR detection on the modified sample DNA.

[0208] Primers and probes:

[0209] Any combination of forward primer, reverse primer and probe of BMP3, select...

Embodiment 3

[0228] A kit for detecting methylation levels of BMP3 and NDRG4 in biological samples

[0229] The kit in this embodiment includes: DNA denaturation solution, sulfite conversion solution, silicon-based membrane column binding solution, DNA desulfurization solution, and PCR reaction solution. Wherein the PCR reaction solution includes PCR buffer, dNTPs, PCR primers, probes and DNA polymerase.

[0230] The forward primers in the PCR of BMP3, NDRG4 and B2M in this example are GTTTAATTTTCGGTTTCGTCGTC (SEQ ID NO: 1) and CGGTTTTCGTTCGTTTTTTTCG (SEQ ID NO: 39), GTAGGTTTGGGTAATTTTAAATAGTGGA (SEQ ID NO: 154), and the reverse primers are CTCCCGACGTCGCTACG ( SEQ ID NO: 58) and TCGTTTATCGGGTATTTTAGTCGCGTAG (SEQ ID NO: 93), TTCTTTCAAAAATATCATCCCCCAAT (SEQ ID NO: 156), the probes are CGCCGAGGCGGTTTTTTGCG (SEQ ID NO: 114) and TTCGTTTATCGGGTATTT (SEQ ID NO: 144), TTCCCTACAAAATCTTCCCCCAAAC ID NO: 158), the combinations of fluorescent substances at the 5' end and 3' end of the probe are respec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer and a probe for detecting methylation levels of BMP3 and NDRG4 in a biological sample and further provides a method and a kit for detecting the methylation levels of BMP3 and NDRG4 in the biological sample by virtue of the primer and the probe. The primer and the probe have high sensitivity and specificity; by virtue of the detection method, early diagnosis information of colorectal tumors can be provided, and a simple, convenient and feasible solution is provided for the early detection of the colorectal tumors.

Description

technical field [0001] The invention belongs to the field of biotechnology and diagnosis research, and relates to a primer and a probe for detecting the methylation level of BMP3 and NDRG4 in a biological sample, and using the primer and probe to detect the methylation level of BMP3 and NDRG4 in a sample, To provide information for early diagnosis of colorectal tumors. Background technique [0002] Colorectal cancer, also known as colorectal cancer, occurs in the colon (large intestine) or rectum and usually develops slowly. It is the second most common cancer in urban China, with 6% of asymptomatic people over the age of 40 suffering from early bowel cancer. With the changes in food structure and living habits, as well as the increasingly prominent environmental problems, the incidence of colorectal cancer has increased rapidly. According to the "China Tumor Registration Annual Report", intestinal cancer is currently the second most common cancer in China after lung cancer....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/154
Inventor 吕宁陈一友杨蛟
Owner HANGZHOU NEW HORIZON HEALTH TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More