Primer and probe for detecting methylation levels of BMP3 and NDRG4 in biological sample
A biological sample, methylation technology, applied in the field of biotechnology and diagnostic research, can solve the problems of long processing cycle, physical trauma and high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0203] PCR reactions were performed using the following items.
[0204] (1) Sample preparation
[0205] Extract DNA from the collected stool samples in the laboratory, take 20-50ul (2-10μg) DNA, add 1 / 10 volume of 3M NaOH (0.3M final concentration, freshly prepared), and incubate in a metal bath at 37-42°C for 20min; add 5 - 10 times the volume of DNA solution with sulfite conversion solution, mix well, and incubate in a metal bath at 50-55°C in the dark for 16 hours; the modified DNA is purified and recovered using a DNA purification column, and 90% ethanol with 0.2-0.3M NaOH is used in the middle Solution for desulfurization; dissolve in 20-40ul H2O and set aside.
[0206] (2) PCR reaction
[0207] According to the PCR reaction system in Table 1, use the following primers and probes to perform fluorescent quantitative PCR detection on the modified sample DNA.
[0208] Primers and probes:
[0209] Any combination of forward primer, reverse primer and probe of BMP3, select...
Embodiment 3
[0228] A kit for detecting methylation levels of BMP3 and NDRG4 in biological samples
[0229] The kit in this embodiment includes: DNA denaturation solution, sulfite conversion solution, silicon-based membrane column binding solution, DNA desulfurization solution, and PCR reaction solution. Wherein the PCR reaction solution includes PCR buffer, dNTPs, PCR primers, probes and DNA polymerase.
[0230] The forward primers in the PCR of BMP3, NDRG4 and B2M in this example are GTTTAATTTTCGGTTTCGTCGTC (SEQ ID NO: 1) and CGGTTTTCGTTCGTTTTTTTCG (SEQ ID NO: 39), GTAGGTTTGGGTAATTTTAAATAGTGGA (SEQ ID NO: 154), and the reverse primers are CTCCCGACGTCGCTACG ( SEQ ID NO: 58) and TCGTTTATCGGGTATTTTAGTCGCGTAG (SEQ ID NO: 93), TTCTTTCAAAAATATCATCCCCCAAT (SEQ ID NO: 156), the probes are CGCCGAGGCGGTTTTTTGCG (SEQ ID NO: 114) and TTCGTTTATCGGGTATTT (SEQ ID NO: 144), TTCCCTACAAAATCTTCCCCCAAAC ID NO: 158), the combinations of fluorescent substances at the 5' end and 3' end of the probe are respec...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 