Brassica napus gene bnmpk3 and its application in resistance to Sclerotinia sclerotiorum

A rapeseed sclerotinia and gene technology, which is applied in the application, genetic engineering, plant genetic improvement and other directions to achieve the effect of fast speed, simple operation and high efficiency

Inactive Publication Date: 2018-08-10
JIANGSU UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore we speculate that BnMPK3 The gene also has the function of improving the resistance of Brassica napus to sclerotinia. In Canadian rape, researchers have cloned BnMPK3 Gene, (Liang et al. Identification and analysis of MKK and MPK gene families in canola (BrassicanapusL.) .BMC Genomics, 2013), but currently for BnMPK3 There are no literature and patent reports on anti-sclerotinia research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brassica napus gene bnmpk3 and its application in resistance to Sclerotinia sclerotiorum
  • Brassica napus gene bnmpk3 and its application in resistance to Sclerotinia sclerotiorum
  • Brassica napus gene bnmpk3 and its application in resistance to Sclerotinia sclerotiorum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: BnMPK3 gene cloning

[0037] (1) BnMPK3 Isolation and cloning of genes

[0038] The variety of Brassica napus Zhongshuang 9 (purchased from the Institute of Plant Oil Plants, Chinese Academy of Agricultural Sciences) was used as the experimental material. The growth conditions were: temperature 20 ± 2°C; humidity 60-90%; photoperiod 8 h per day 16 h dark; light intensity 44 μmol m –2 the s –1 .

[0039] Extraction of total RNA from rapeseed leaves and synthesis of cDNA used UNIQ-10 column Trizol kit (purchased from Shanghai Yingjun Biotechnology Co., Ltd.), and DNase Ⅰ (Bao Bioengineering (Dalian) Co., Ltd.) was used to remove the mixed For a small amount of DNA, the integrity of the total RNA was checked by 1% agarose gel electrophoresis. The cDNA was synthesized according to the operating instructions of the MMLV Reverse Transcriptase Kit (Promega (Beijing) Biotechnology Co., Ltd.), and 50 μmol / LOligo(dT)18 (Thermo Fisher Scientific) was used as the ...

Embodiment 2

[0044] Example 2: BnMPK3 Response to Sclerotinia

[0045] (1) Treatment of Sclerotinia

[0046] Sclerotinia sclerotiorum pathogen Sclerotinia sclerotiorum (isolated from Zhongshuang No. 9 variety of Brassica napus (purchased from the Plant Oil Institute of Chinese Academy of Agricultural Sciences) on the third leaf of rapeseed seedlings (at the four-leaf one-heart stage) was activated in the laboratory ) inoculation treatment, the plants were cultured at 23°C for 4-5 days before treatment, and then the leaves were kept in a dark environment for 24 hours. Then inoculate with mycelium blocks of Sclerotinia sclerotiorum, and control with sterile medium blocks. Samples were taken at 0 h, 12 h, 24 h, 36 h, and 48 h after inoculation.

[0047] (2) Extraction of Brassica napus RNA

[0048] The total RNA of the leaves after 0h, 12h, 24h, 36h, and 48h of S. sclerotiorum treatment in step 1 was extracted by plant Trizol (Shanghai Handsome Biotechnology Co., Ltd.).

[0049] (3) Real...

Embodiment 3

[0063] Example 3: Overexpression BnMPK3 Obtaining of Transgenic Rapeseed Plants

[0064] (1) Plant overexpression vector construction

[0065] Primers were designed using Primer Premier 5.0 software according to the CaMV 35S sequence (Gene ID: AJ007626) published on NCBI

[0066] 5′-GAATTCTTAATTAAGAGCTCGCATGCC-3′ and

[0067] 5'-GGTACCGTCCCCGTGTTTCTCCAA-3', the CaMV 35S fragment was amplified from the pEGAD vector (purchased from Treasure Bioengineering (Dalian) Co. Technology Co., Ltd.) EcoRI / KpnI restriction sites; at the same time, use Primer Premier 5.0 software to design primers according to the CaMVNos sequence published on NCBI (Gene ID: AJ007624)

[0068] 5′- GGATCCGAATTTCCCCGATCGTTCAA′-3′ and

[0069] 5′-AAGCTTGATCTAGTAACATAGATGACACCGC-3′, the CaMVNos fragment was amplified from the pEGAD vector by PCR and ligated into the pCAMBIA1300 vector Bam HI / Hin dIII restriction site, the pCAMBIA1300-35S-Nos vector is obtained. Endonuclease EcoRI, KpnI, Bam HI and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses gene BnMPK3 capable of controlling sclerotinia rot of cabbage type rape and an application of the gene BnMPK3, belonging to the field of plant genetic engineering. The invention mainly relates to separation and cloning, functional verification and an application of the gene BnMPK3 capable of controlling the sclerotinia rot of cabbage type rape, and the gene BnMPK3 has the function of controlling the sclerotinia rot of crops. Through experimental verification, the expression quantity of BnMPK3 is obviously improved when the sclerotinia rot acts on the cabbage type rape, and the means of improving the expression quantity of the gene BnMPK3 by the genetic engineering technology can control the sclerotinia rot of the crop, thus the disease resistance and the yield of the cabbage type rape and other crops are improved.

Description

technical field [0001] The invention relates to a gene for controlling Sclerotinia sclerotiorum of Brassica napus BnMPK3 The application of the invention and its functional analogue regulating plant anti-sclerotinia in agricultural production belongs to the field of plant genetic engineering. Background technique [0002] As an important oil crop, rape plays an important role in China's oil production. The annual planting area of ​​rapeseed in my country is 7 million hectares (100 million mu), accounting for 1 / 3 of the world, ranking first in the world, and the rapeseed oil it produces accounts for 40% of my country's entire edible vegetable oil supply (Shen Jinxiong et al., Chinese rapeseed production and Potential of Genetic Improvement and Prospect of Rapeseed Biodiesel [J], Journal of Huazhong Agricultural University, 2007, Vol. 26, No. 6, pp. 894-899). In addition, rapeseed oil is also suitable for the production of biodiesel, and rapeseed has been regarded as an impor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/84C12N15/54A01H6/20
Inventor王政陈婷谭小力方和娣李霄陈克平王杰利张志燕李冠英
OwnerJIANGSU UNIV