Endolysin derived from Vibrio parahaemolyticus phage, and application of endolysin
A technology of Vibrio hemolyticus and bacteriophage, applied in the field of endolysin, can solve the problem that the prevention and control of Gram-negative bacteria is still less and other problems, and achieve the effect of significant bactericidal effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1: Prediction of endolysin protein function
[0031] The present inventor isolated a virulent phage qdvp001 of Vibrio parahaemolyticus from sewage. After whole genome sequencing and analysis, it was identified that the protein encoded by the phage ORF60 had 56% similarity in amino acid sequence with the substrate and tail hydrolase of Vibrio phage ICP1. Domain prediction analysis of ORF60-encoded protein Lysqdvp001 was performed using SMART software. The domain prediction results are as follows figure 1 As shown, the 9-65 amino acid region of Lysqdvp001 is a highly conserved functional region, belonging to the PG_binding (PF01471) domain, which is related to the binding of cell wall peptidoglycan. The 123-216 amino acid interval of Lysqdvp001 is a highly conserved functional region, which belongs to the CHAP family (PF05257), which is related to the hydrolysis of prokaryotic cell wall peptidoglycan.
Embodiment 2
[0032] Example 2: High expression of endolysin in Escherichia coli
[0033] 1. Construction of recombinant plasmids
[0034] According to the endolysin gene sequence (SEQ ID No: 2), primers were designed, upstream primer: CGGGATCCATGACTTTAATTCGTAAGGGTAGTCG (SEQ ID No: 3), downstream primer: CCGCTCGAGTTAAGCTTCGTTATTACTAGTTACATCTGA (SEQ ID No: 4), restriction enzymes BamHI and XhoI. The endolysin gene was amplified by PCR, and 25 μL of the PCR recovered product was cloned into the multiple cloning site BamHI and XhoI of the pET-30a vector to obtain a recombinant plasmid, which was transformed into Escherichia coli Rosetta (DE3). Single clones were picked and cultured in LB liquid medium with shaking at 37°C for 5 hours, and then sent to Shanghai Sangong for sequencing. Sequencing results showed that the plasmid had the nucleotide sequence shown in SEQIDNo: 2, and the protein expressed by the gene was named Lysqdvp001, and the gene encoded the amino acid residue sequence shown ...
Embodiment 3
[0037] Example 3: Taking Vibrio parahaemolyticus ATCC17802 as the target bacterium to test the antibacterial effect of endolysin LysVPp1
[0038] Pick a single colony of Vibrio parahaemolyticus ATCC17802 into 300mL2216E medium, cultivate overnight, centrifuge the bacteria, reconstitute with 100mM EDTA for 5min, wash the cells twice with pure water, and then store them at -80°C. Before measuring the activity, the bacteria The precipitate was reconstituted with 50mmol / LpH8.2 Tris containing 0.1% TritonX-100. Add 100 μL of recombinant protein Lysqdvp001 solution (400 μg / mL) to 100 μL of bacterial reconstitution solution, and mix the buffer and lysozyme (400 μg / mL) with the bacterial reconstitution solution as the blank group and positive control group respectively, and culture under the same conditions , Measure the OD450 value with a microplate reader, and the decrease in absorbance reflects that the bacteria are lysed.
[0039] The result is as image 3 As shown, the absorban...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
