Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detecting kit for severe fever with thrombocytopenia syndrome viruses (SFTSV) and preparation method of detecting kit

A virus detection and kit technology, applied in the biological field, can solve the problems of expensive, prone to false positives, etc., and achieve the effect of easy operation

Inactive Publication Date: 2016-02-03
JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Real-timetimePCR method and LAMP method have good specificity and sensitivity, but the former relies on expensive instruments and reagents; while the latter is prone to false positives due to cross-contamination

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detecting kit for severe fever with thrombocytopenia syndrome viruses (SFTSV) and preparation method of detecting kit
  • Detecting kit for severe fever with thrombocytopenia syndrome viruses (SFTSV) and preparation method of detecting kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Embodiment 1: Target gene plasmid construction

[0018] Design specific primers for the L fragment (F2705: 5'TGGAAGGCAGTTCTGGATGACGG3'; R3594: 3'GTAAAGGTGTCCGTGAACCAATC5'), amplify by PCR to obtain a 890bp nucleotide fragment, recover and purify it and connect it with the T vector to obtain a positive plasmid for the target gene. Named Puc-L.

Embodiment 2

[0019] Embodiment 2: Primer probe design and screening

[0020] Through the analysis of sequence analysis software, using the sequence between 2945-3154 of the relatively conservative L segment of SFTSV virus as a template, a total of 8 forward primers and 9 reverse primers were designed, and the length of the primers was 30-35bp; at the same time, 1 exo probe was designed (named L-exo-probe), with a length of 52bp, in which the 30th base T is labeled with the fluorescent substance FAM, the 33rd base T is replaced by tetrahydrofuran, the 35th base is labeled with the fluorescent substance BHQ, and the 3` terminal base is blocked at the same time .

[0021] Using TwistAmpBasickit (TwistDx Company, UK), the target gene cloning plasmid Puc-L was used as a template, and agarose gel electrophoresis was used as a result indicating means to screen the primers designed above. The evaluation indicators of primer quality include specificity, sensitivity, amplification efficiency and pr...

Embodiment 3

[0022] Example 3: Sensitivity of RT-RPA

[0023] Dilute the target gene cloning plasmid Puc-Ls 100 times, and then dilute it into 10 times by 10 times -2 -10 -9 A total of eight concentrations were used as templates for RT-RPA reactions: using the TwistAmpRTexos kit (TwistDx, UK). Take 29.5 μL reaction buffer and add the following components respectively: 2.1 μL each of primer L-RPAF (10 mM) and L-RPAR (10 mM), 2.6 μL RPAexo probe (10 mM), 1 μL RNase inhibitor (5 U), 7.2 μL supernatant Pure water, 5 μL sample RNA template. Vortex 8-10 times and centrifuge briefly. Another 2.5 μL of magnesium acetate (280 mM) was added. After mixing and centrifuging, put them into a Twista real-time fluorescence detector, the reaction temperature is 40°C, and the reaction time is 20 minutes.

[0024] The RT-RPA method established in this experiment can detect the lower limit is 10copies / μL, which has good sensitivity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology and particularly relates to a reverse transcription-recombinase polymerase amplification (RT-RPA) detecting kit for severe fever with thrombocytopenia syndrome viruses (SFTSV) and a preparation method of the detecting kit. The detecting kit is composed of an RT-RPA reaction system, an RNA enzyme inhibitor, an SFTS virus fragment L positive plasmid Puc-L, a negative quality control, a fragment L RPA primer and an exo probe. A rapid, sensitive and specific isothermal real-time fluorescent nucleic acid detection method for SFTSV is established by using the specific primer and the probe through real-time fluorescent detection realized by preparing the RT-RPA reaction system and placing a Twista real-time fluorescent detection instrument to carry out real-time fluorescent detection. The invention relates to application of the specific RPA primer and the exo probe to clinical differential diagnosis of SFTSV infection and identification of a virus isolate strain.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a detection kit for fever with thrombocytopenia syndrome virus reverse transcription-recombinase polymerase amplification (RT-RPA) and a preparation method thereof. Background technique [0002] Severe fever with thrombocytopenia syndrome virus (Severefeverwiththrombocytopeniasyndromevirus, SFTSV) belongs to the Bunyaviridae family and is a newly discovered virus that can cause hemorrhagic disease in my country in recent years. The viral genome includes three single-stranded negative-strand RNA segments, large (L), medium (M), and small (S). The L segment encodes RNA-dependent RNA polymerase; the M segment encodes glycoproteins Gn and Gc; the S segment encodes viral nucleoprotein N and nonstructural protein NSs in a bidirectional manner. The virus is mainly distributed in rural areas in mountainous and hilly areas, sporadic, and the population is generally susceptible. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/6844C12Q2521/507C12Q2527/101C12Q2563/107
Inventor 祁贤宋勇春邢铮焦永军李志锋汤奋扬鲍倡俊
Owner JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com