L-aspartase recombinant escherichia coli free of malic acid byproducts and construction method and application of L-aspartase recombinant escherichia coli

A technology for recombining Escherichia coli and aspartase, applied in the field of bioengineering, can solve the problems of reducing the conversion rate of target products, increasing the difficulty of separation and purification of downstream products, etc., so as to reduce the production of by-products, reduce production costs, and improve The effect of conversion yield

Active Publication Date: 2016-02-10
NANJING UNIV OF TECH
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The synthesis of by-product malic acid not only reduces the conversion rate of the target product, but also increases the difficulty of separation and purification of downstream products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • L-aspartase recombinant escherichia coli free of malic acid byproducts and construction method and application of L-aspartase recombinant escherichia coli
  • L-aspartase recombinant escherichia coli free of malic acid byproducts and construction method and application of L-aspartase recombinant escherichia coli
  • L-aspartase recombinant escherichia coli free of malic acid byproducts and construction method and application of L-aspartase recombinant escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] This example illustrates the process of knocking out the fumarase fumB gene in the parental ammonium-resistant Escherichia coli BEW308 by using homologous recombination technology to obtain an apramycin-resistant strain.

[0033] (1) Using LB medium, cultivate Escherichia coli BEW308 to OD at 37°C under aerobic conditions 600 =0.4~0.6, prepared as electrotransfer competent;

[0034] (2) Electrotransform the recombinant plasmid into competent Escherichia coli BEW308. The electric shock conditions are: 200Ω, 25μF, electric shock voltage 2.3kv, electric shock time 4-5ms. Immediately after the electric shock, the bacteria were added to pre-cooled 1mL SOC medium, cultured at 150r / min, 30°C for 1h, and then spread on the LB medium plate with ampicillin (amp) to screen out the positive transformant BEW308 (pKD46);

[0035] (3) Adding 10 mM L-arabinose to LB medium, inducing plasmid pKD46 to express λ recombinase at 30°C to make electroporation competent;

[0036] (4) Using ...

Embodiment 2

[0047] This example illustrates the use of homologous recombination technology to further knock out the fumarase fumAC gene in Escherichia coli BEW308 (ΔfumB), and introduce a mutant highly active aspartase gene.

[0048] The whole experimental operation process is consistent with Example 1, only the homologous sequence is different.

[0049] (1) In this example, the L-aspartase gene (aspC) of EscherichiacoliK12 is used as the starting sequence, and the 236 and 249 amino acids are mutated, that is, Lys236Asn, Gly249Thr, and a signal is added upstream of the initiation codon ATP Peptide sequence atgttgaatccgaaggttgcctacatggtctggatgacgtgcctgggtttaacgttgcccagccaggca (shown in SEQ ID NO: 2), finally adding fumAC homology arms and apramycin resistance gene sequences at both ends, the entire gene is synthesized artificially, and the specific nucleotide sequence is shown in SEQ ID NO: 5 shown.

[0050] (2) The artificially synthesized linear DNA fragment was electroporated to BEW308...

Embodiment 3

[0052] This example compares and investigates the change of fumarase and aspartase activities of the starting strain EscherichiacoliBEW308 and the recombinant strain EscherichiacoliBEW308 (△fumB, △fumAC-aspC) in FM fermentation medium and the activity of aspartic acid Comparison data at the time of conversion.

[0053] Specific steps are as follows:

[0054] (1) Use LB medium, transfer the inoculum amount from the cryopreservation tube to the Erlenmeyer flask according to 1-2% (v / v) inoculum amount, culture aerobically for 10-12 hours, and further increase the inoculum amount according to 1-2% (v / v) Inoculate into shake flasks or seed fermenters (the culture medium is also LB). The temperature of the seed cultivation process is controlled at 35-37°C. There is no need to adjust the pH during the cultivation, and the dissolved oxygen is controlled at 5-40%. After 4-6 hours of cultivation, the bacteria Body OD 600 Between 2.5 and 4, the fermentation medium FM is inoculated at 5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses L-aspartase recombinant escherichia coli free of malic acid byproducts. The genes fumA, fumB and fumC of encoded fumarase in ammonium-tolerant escherichia coli BEW308 are inactivated, then encoded L-aspartase genes are inserted into the positions of encoded fumarase fumAC genes, and the L-aspartase recombinant escherichia coli free of the malic acid byproducts is obtained. The preservation number of a strain of the ammonium-tolerant escherichia coli BEW308 is CCTCC NO:M2013157. The invention further discloses a construction method and application of the strain. The constitutive high-activity expression of L-aspartase can be achieved, and cells or crude enzyme obtained after fermental cultivation has low fumarase activity.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a strain of L-aspartase-producing recombinant Escherichia coli without malic acid by-product and its construction method and application. Background technique [0002] L-Aspartic acid is widely used in medicine, food and chemical industry. In medicine, it is the main component of amino acid preparations; in chemical industry, it can be used as a raw material for the manufacture of synthetic resins, and is widely used in the synthesis of polyaspartic acid, an environmentally friendly material; especially in the food industry, L-aspartic acid is a It is a good nutritional supplement and is also the main raw material for the production of sugar substitute aspartame. Has a good market prospect. [0003] At present, L-aspartic acid is mainly synthesized from fumaric acid by biological enzyme method. Since whole cells or broken cells are used for transformation, t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12P13/20C12R1/19
Inventor马江锋吴若凡姜岷吴昊
OwnerNANJING UNIV OF TECH