A rapid screening system for exogenous gene knock-in Lactococcus lactis and its construction method and application

A Lactococcus lactis, exogenous gene technology, applied in microorganism-based methods, biochemical equipment and methods, bacteria, etc., can solve the problems of time-consuming, labor-intensive, and heavy workload.

Inactive Publication Date: 2019-06-18
ARMY MEDICAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since double crossover homologous recombination is a small probability event, it is often necessary to select thousands of clones to screen the target strain. The workload is very large, time-consuming and labor-intensive.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A rapid screening system for exogenous gene knock-in Lactococcus lactis and its construction method and application
  • A rapid screening system for exogenous gene knock-in Lactococcus lactis and its construction method and application
  • A rapid screening system for exogenous gene knock-in Lactococcus lactis and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1: Construction of thermosensitive plasmid pJW.

[0066] 1) Primer design: according to the NZ9000 genome his gene sequence (SEQ ID NO: 2), Ts-Em r Fragment sequence (SEQ ID NO: 5) design PCR primer, base sequence is as follows:

[0067] Primer name

Primer sequence (underlined is the introduced restriction site)

Restriction sites

HisF

AAA GAATTC TAAAGTAATTTTCATCAATTTTTTCTAAGC

EcoRI

HisR

GTTTGGGAGTCGCCTTTGGCTC

-

Tf

AAA GGATCC TGATCGTTAAATTTATACTGCAAT

BamHI

TT

AAA CTGCAG TACCTAATAATTTATCTACATTCCC

PstI

[0068] 2) PCR amplification of his gene: using NZ9000 genomic DNA as a template, PCR was performed with primers HisF (SEQ ID NO: 18) and HisR (SEQ ID NO: 19) to amplify his gene, the method is as follows:

[0069] The reaction system of PCR is:

2×Primer S TAR Max Premix

25 μL

NZ9000 genome

1μL

Primer HisF (20μM)

1μL

Primer ...

Embodiment 2

[0079] Example 2 Construction of the knock-in vector pJW-PZLT of the lacZ gene expression sequence (PZLT fragment).

[0080] 1).P nisZ Fragment Synthesis: According to P nisZ Promoter sequence (SEQ ID NO: 6), synthesized by Huada Gene promoter P nisZ and cloned into the pEASY plasmid to construct the plasmid pEASY-P nisZ .

[0081] 2). Overlap PCR to obtain the PZL fragment:

[0082] (1). Primer design: according to P nisZ Sequence, Lactobacillus acidophilus β-galactosidase lacZ gene sequence (SEQ ID NO: 7) designed Overlap PCR primers, the base sequence is as follows:

[0083]

[0084] Among them, PZR and LF have a 30bp complementary sequence.

[0085] (2). With pEASY-P nisZ The plasmid was used as a template, and PCR was carried out with primers PZF (SEQ ID NO: 22) and PZR (SEQ ID NO: 23) to amplify P nisZ Fragment, the method is as follows:

[0086] The reaction system of PCR is:

2×PrimerSTAR Max Premix

25 μL

pEASY-P nisZ plasm...

Embodiment 3

[0105] Example 3 Construction, screening and identification of Lactococcus lactis NZ9000 strain PZLT fragment knock-in strain

[0106] 1). Preparation of Lactococcus lactis electroporation competent cells:

[0107] The recipient bacterium Lactococcus lactis (NZ9000) was inoculated in M17GS medium, and after static culture at 30°C overnight, inoculated with SGM17 medium at a ratio of 1:100, and cultured statically at 30°C until the bacterial solution OD 600= 0.2 to 0.3 (about 4 hr). The bacterial solution was quickly cooled on ice for 30 minutes, refrigerated and centrifuged at 3200g for 30 minutes at 4°C, and the supernatant was discarded. Place the bacteria on ice, gently resuspend with about 200mL pre-cooled GS solution, centrifuge at 3200g, 4°C for 20min, discard the supernatant; repeat the above step twice (the GS solution is reduced to 100mL and 50mL respectively). Add 1 mL of GS solution to the bottom of the bacteria to resuspend, and use immediately after aliquoting o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
capacitanceaaaaaaaaaa
Login to View More

Abstract

The invention provides a rapid screening system for Lactococcus lactis with knocked-in exogenous genes. The screening system comprises temperature-sensitive plasmids and the Lactococcus lactis, wherein the temperature-sensitive plasmids contain his gene segments and temperature-sensitive replicon-erythromycin resistance gene (Ts-Emr) segments; chromosomes of the Lactococcus lactis contain lacZ gene expression segments. lacZ genes of the Lactococcus lactis cannot be expressed when the exogenous genes are knocked in successfully, so that white colonies are shown on a solid medium containing X-Gal, otherwise, blue colonies are shown, the change from the blue colonies to the white colonies can be directly observed on the solid medium, the screening workload can be greatly reduced, and screening time can be greatly shortened.

Description

technical field [0001] The invention belongs to biological technology, specifically a new method for cloning an exogenous gene into the chromosome of Lactococcus lactis (Lactococcuslactis, L. More convenient and faster. Background technique [0002] Lactococcus lactis (L.Lactis) is a non-invasive, non-pathogenic, food-safe, Gram-positive coccus traditionally used in the production of a variety of foods (e.g. cheese, butter, etc.) . Due to its important application value, Lactococcus lactis has been widely and deeply studied since the 1980s, and its biochemical, immune and genetic backgrounds have been studied clearly. Due to its good safety, Lactococcus lactis is widely used to express various foreign proteins, including various enzymes, therapeutic protein products and vaccine components, and is used in the fields of food industry, biopharmaceuticals and vaccine development, and has important economic value. Among them, L. lactis subsp. cremoris MG1363 and NZ9000 are mo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/74C12N1/21C12Q1/04C12R1/01
CPCC12N1/20C12N15/746C12Q1/04
Inventor王竞殷素鹏胡福泉赵泽孝
OwnerARMY MEDICAL UNIV