A bt protein cry2ab32, its coding gene and application
A technology encoding a gene, cry2ab32, is applied in Bt protein and its encoding gene and application fields to achieve the effects of improving insect resistance, important economic value and application prospects, and reducing costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Cry2Ab32 Gene cloning
[0033] The present invention is a Bacillus thuringiensis isolated from the soil in Chengdu, Sichuan Province ( Bacillus thuringiensis ) The new strain BN23-5, which has been in the General Microbiology Center of the China Microbial Culture Collection Management Committee on July 14, 2014 (Address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Zip code 100101) preserved, classified as Bacillus thuringiensis ( Bacillus thuringiensis ), the deposit number is CGMCC No.9448.
[0034] This example was cloned by the following method Cry2Ab32 The full-length sequence of the gene.
[0035] Use genomic DNA purification kit (purchased from Cybersun) to extract the total DNA of strain BN23-5 as amplification Cry2Ab32 Gene template, design primer sequence is as follows:
[0036] P1 (SEQ ID NO.3): 5’-ATGAATAGTGTATTGAATAGCG -3;
[0037] P2 (SEQ ID NO.4): 5’- TTAATAAAGTGGTGAAATATTAGT-3’...
Embodiment 2
[0048] Example 2 Cry2Ab32 Protein acquisition
[0049] according to Cry2Ab32 Design and synthesize a pair of specific primers 2ATF (SEQ IDNO.5): 5'-GCC GGATCC ATGAATAGTGTATTGAATAGCG-3', 2ATR (SEQ ID NO.6): 5'-CCC CTCGAG TTAATAAAGTGGTGAAATATTAGT -3', 5'end primers underlined bases are respectively BamH I with XHo I Restriction sites. Use the total DNA of BN23-5 as a template for amplification, and the digested product is ligated with the vector pET-28a(+) after the same double digestion, and transformed E. coli After extracting DH5α competent cells, the plasmids were digested and electrophoresed to verify that the size of the inserted fragment was in line with the expected target fragment ( figure 2 ), then transferred to the recipient bacteria E.coli .BL21(DE3) (purchased from Beijing Quanshijin Biotechnology Co., Ltd.). The recombinant plasmid was named pET-2A, and the recombinant containing the recombinant plasmid was named E.coli .BL21(2A). The positive transformant...
Embodiment 3
[0051] Example 3 Cry2Ab32 Protein insecticidal activity determination
[0052] Example 2 is obtained Cry2Ab32 The protein was tested for its insecticidal activity against Plutella xylostella, corn borer and cotton bollworm. Plutella xylostella bioassay: will Cry2Ab32 The protein is formulated into 6 different concentration gradients such as 34, 17, 8.5, 4.25, 2.125, 0.1 ug / mL, etc.; select the moderately old and tender cabbage leaves, wash and dry; irradiate under UV light for 15 minutes, and cut into 2×2cm 2 Size, put in different concentrations of bacterial solution, soak for 5min; take out the excess liquid, put it in a sterilized petri dish to dry, use LB soaked leaves as a control, put 4 leaves in each petri dish; choose healthy 20 2-3 instar diamondback moths; each treatment was repeated 3 times, placed indoors, and the death of the larvae was investigated 3 days later.
[0053] Corn borer bioassay: will Cry2Ab32 The protein is formulated into 6 different concentration gr...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


