Unlock instant, AI-driven research and patent intelligence for your innovation.

A bt protein cry2ab32, its coding gene and application

A technology encoding a gene, cry2ab32, is applied in Bt protein and its encoding gene and application fields to achieve the effects of improving insect resistance, important economic value and application prospects, and reducing costs

Active Publication Date: 2018-11-30
SICHUAN AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, studies have shown that resistance to Bti has not been found in field use, but mosquito resistance to it has been continuously confirmed in the laboratory, and this situation may also appear in field (Georghiou G P, 1997. Applied and Environmental Microbiology, 63:1095-1101.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A bt protein cry2ab32, its coding gene and application
  • A bt protein cry2ab32, its coding gene and application
  • A bt protein cry2ab32, its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Cry2Ab32 Gene cloning

[0033] The present invention is a Bacillus thuringiensis isolated from the soil in Chengdu, Sichuan Province ( Bacillus thuringiensis ) The new strain BN23-5, which has been in the General Microbiology Center of the China Microbial Culture Collection Management Committee on July 14, 2014 (Address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Zip code 100101) preserved, classified as Bacillus thuringiensis ( Bacillus thuringiensis ), the deposit number is CGMCC No.9448.

[0034] This example was cloned by the following method Cry2Ab32 The full-length sequence of the gene.

[0035] Use genomic DNA purification kit (purchased from Cybersun) to extract the total DNA of strain BN23-5 as amplification Cry2Ab32 Gene template, design primer sequence is as follows:

[0036] P1 (SEQ ID NO.3): 5’-ATGAATAGTGTATTGAATAGCG -3;

[0037] P2 (SEQ ID NO.4): 5’- TTAATAAAGTGGTGAAATATTAGT-3’...

Embodiment 2

[0048] Example 2 Cry2Ab32 Protein acquisition

[0049] according to Cry2Ab32 Design and synthesize a pair of specific primers 2ATF (SEQ IDNO.5): 5'-GCC GGATCC ATGAATAGTGTATTGAATAGCG-3', 2ATR (SEQ ID NO.6): 5'-CCC CTCGAG TTAATAAAGTGGTGAAATATTAGT -3', 5'end primers underlined bases are respectively BamH I with XHo I Restriction sites. Use the total DNA of BN23-5 as a template for amplification, and the digested product is ligated with the vector pET-28a(+) after the same double digestion, and transformed E. coli After extracting DH5α competent cells, the plasmids were digested and electrophoresed to verify that the size of the inserted fragment was in line with the expected target fragment ( figure 2 ), then transferred to the recipient bacteria E.coli .BL21(DE3) (purchased from Beijing Quanshijin Biotechnology Co., Ltd.). The recombinant plasmid was named pET-2A, and the recombinant containing the recombinant plasmid was named E.coli .BL21(2A). The positive transformant...

Embodiment 3

[0051] Example 3 Cry2Ab32 Protein insecticidal activity determination

[0052] Example 2 is obtained Cry2Ab32 The protein was tested for its insecticidal activity against Plutella xylostella, corn borer and cotton bollworm. Plutella xylostella bioassay: will Cry2Ab32 The protein is formulated into 6 different concentration gradients such as 34, 17, 8.5, 4.25, 2.125, 0.1 ug / mL, etc.; select the moderately old and tender cabbage leaves, wash and dry; irradiate under UV light for 15 minutes, and cut into 2×2cm 2 Size, put in different concentrations of bacterial solution, soak for 5min; take out the excess liquid, put it in a sterilized petri dish to dry, use LB soaked leaves as a control, put 4 leaves in each petri dish; choose healthy 20 2-3 instar diamondback moths; each treatment was repeated 3 times, placed indoors, and the death of the larvae was investigated 3 days later.

[0053] Corn borer bioassay: will Cry2Ab32 The protein is formulated into 6 different concentration gr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a Bt protein CRY2Ab32 and a coding gene thereof. The protein is of an amino acid sequence shown in the SEQIDNo.2 or of an amino acid sequence obtained by replacing, missing and / or adding one or more amino acids of the amino acid sequence shown in the SEQIDNo.2, wherein the amino acid sequence is the same as the amino acid sequence shown in the SEQIDNO.2 in activity. The protein can be used for preparing a Bt pesticide, the gene for coding the protein can convert cotton, corns, rice, vegetables and other crops, and the corresponding insect resistant activity is achieved, so that the pesticide using amount is lowered, environment pollution is reduced, and the important economic value and application prospects are achieved.

Description

Technical field [0001] The invention relates to the field of biotechnology, in particular to a Bt protein and its coding gene and application. Background technique [0002] In the human production process, insect pests are an important factor that causes agricultural production losses and affects human health. According to FAO statistics, the annual economic loss caused by insect pests in agricultural production around the world is as high as 14%, disease loss is 12%, and weed loss is 11%. The loss amounted to US$126 billion, equivalent to half of China's total agricultural output value and more than four times that of the UK. In order to reduce these losses, for many years, crop pests and mosquitoes have been generally controlled by chemical control methods. However, due to the long-term and large-scale use of chemical pesticides, the environment has been polluted. The pesticide residues in agricultural and sideline products have increased, which is vital to human survival. An...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/325C12N15/32C12N15/82C12N5/10A01H5/00A01H6/46A01N47/44A01N63/02A01P7/04
Inventor 郑爱萍余宗兰李平陈磊龚莉王玲霞刘怀年邓其明王世全李双成朱军
Owner SICHUAN AGRI UNIV