Epidemic encephalitis B/yellow fever chimeric virus and preparation method and application thereof

A chimeric virus and yellow fever technology, applied in the direction of botany equipment and methods, biochemical equipment and methods, applications, etc., to achieve the effect of preventing yellow fever virus infection, good safety, and ensuring immune protection effect

Active Publication Date: 2016-03-16
CHENGDU INST OF BIOLOGICAL PROD
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there is no report of using yellow fever virus as a donor strain to prepare a yellow fever chimeric virus that can prevent yellow fever

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Epidemic encephalitis B/yellow fever chimeric virus and preparation method and application thereof
  • Epidemic encephalitis B/yellow fever chimeric virus and preparation method and application thereof
  • Epidemic encephalitis B/yellow fever chimeric virus and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1 Construction of chimeric virus of the present invention

[0032] 1. Construction and identification of full-length infectious full-length cDNA clone containing JEV vaccine strain SA14-14-2 and recovery of recombinant virus

[0033] 1. Modification of multiple cloning sites of low-copy plasmid pACNR

[0034] Dissolve Oligo-1 (5'-CGCGCCATTAGGCGCCTTATAGATCTAATGTCCGGATTATGGATCCTGATTGATCATTATTTCTAGAATTAC-3', the underlines are KasI, BglII, BspEI, BamHI, BclI, XbaI recognition sites) and Oligo-2 (5'-TCGAGTAATTCTAGAATAATGATCAATCAGGATCCATAATCCGGAGCATTAGOCTA' respectively, and After the formation of complementary double strands, the 5' and 3' ends respectively form AscI and Xhol enzyme-digested sticky ends, both of which are prepared by Shanghai Yingwei Jieji Biotechnology Co., Ltd.) in 100 μl sterilized double-distilled water, mix 10 μl each, and heat to Cool naturally at 100°C, take 2 μl and connect with pACNR double-digested with AscI and Xhol at 4°C overnight (...

Embodiment 2

[0094] The preparation of embodiment 2 vaccines of the present invention

[0095] The chimeric virus Chimeri-JYF prepared in Example 1 was inoculated into primary hamster kidney cells (PHK cells) according to 0.001-0.1 M.O.I, and after being adsorbed at 36°C±1°C for 1h, added with a final concentration of 0.1% human serum white The protein MEM maintenance solution was cultured at 36°C±1°C for 2-5 days. After the cells showed obvious CPE (cytopathic changes), the supernatant was harvested and filtered to become the vaccine stock solution.

[0096] The vaccine of the present invention is obtained by adding pharmaceutically acceptable adjuvants or auxiliary components to the vaccine stock solution.

[0097] The beneficial effect of the present invention is illustrated below in the mode of experimental example:

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Titeraaaaaaaaaa
Login to View More

Abstract

The invention discloses cDNA cloning of an epidemic encephalitis B / yellow fever chimeric virus. The nucleotide sequence of the virus is as shown in SEQ ID NO.1. The invention further discloses the epidemic encephalitis B / yellow fever chimeric virus, application thereof and a vaccine preventing yellow fever. The chimeric virus Chimeri-JYF is small in toxicity and good in immune protection function. The vaccine prepared through the virus can effectively prevent yellow fever virus infection, is high in safety, can be used for replacing existing yellow fever live attenuated vaccines (17D strains), effectively improves clinical use safety while the immune protection function is guaranteed, and is good in application prospect.

Description

technical field [0001] The invention relates to a chimeric virus, in particular to a Japanese encephalitis / yellow fever chimeric virus and its preparation method and application. Background technique [0002] Yellow fever is a mosquito-borne infectious disease caused by yellow fever virus infection and mainly occurs in sub-Saharan Africa and tropical South America. The incidence is about 200,000 cases per year, and the mortality rate is as high as 20-50%. 90% of these occur in Africa. Yellow fever virus infection in humans can cause a variety of clinical symptoms ranging from subclinical infection to life-threatening multiple organ failure, jaundice, and hemorrhage, and it is a serious disease for residents living in and travelers to endemic areas. serious public health threat. Since there are currently no effective antiviral drugs against yellow fever, yellow fever vaccination is the only effective way to prevent infection. At present, the commonly used vaccine is live a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/40C12N7/01A61K39/12A61P31/14C12R1/93
CPCA61K39/12A61K2039/5256C07K14/005C12N7/00C12N2770/24121C12N2770/24134C07K14/18Y02A50/30
Inventor杨会强汪伟何婷刘莉娜赵宇刘俐曾献武
OwnerCHENGDU INST OF BIOLOGICAL PROD