A method for detecting Palmer amaranth by using pcr primers

An amaranthus amaranthus, primer pair technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as indistinguishable, lack of basic technical data, etc. Strong, method-reliable results

Inactive Publication Date: 2019-01-22
ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the seeds of Amaranth are small, about 1 mm in length, and have similar morphological characteristics, making it difficult to distinguish them. There is a lack of basic technical information for port identification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for detecting Palmer amaranth by using pcr primers
  • A method for detecting Palmer amaranth by using pcr primers
  • A method for detecting Palmer amaranth by using pcr primers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1: Extraction of plant material genomic DNA

[0019] The seeds of Amaranthus in this experiment came from the Phytosanitary Laboratory of Animal, Plant and Food Center of Tianjin Entry-Exit Inspection and Quarantine Bureau. There are 21 species in total, and the relevant information is shown in Table 1.

[0020] Table 1 Code, Latin name, Chinese name and year of collection of test materials

[0021]

[0022]

[0023] Use sterilized tweezers to pick the plant seeds and put each amaranth seed into 1.5mL

[0024] Add 0.03 g of quartz sand to each tube, grind with liquid nitrogen, extract DNA according to the DNA extraction kit produced by QIAGEN, dissolve the DNA in 100 μL of 1×TE buffer, and store at -20°C.

Embodiment 2

[0025] Embodiment 2: the design of specific primer

[0026] The specific primers for the artificial synthesis of Palmer amaranth, the primer sequence is as follows:

[0027] PALF: TGGTACAGGTAGGGA AGA

[0028] PALR: ACATAAAATATTACAATCGACGCA

Embodiment 3

[0029] Embodiment 3: PCR amplification of Palmer amaranth specific primer

[0030] 1. Preparation of reaction mixture

[0031] The configuration of the reaction system is shown in Table 2.

[0032] Table 2 Amaranth specific amplification system

[0033]

[0034] 2. PCR reaction procedure

[0035] Pre-denaturation: 94°C, 3min

[0036] Denaturation: 94°C, 30s

[0037] Annealing: 57℃, 30s

[0038] Extension: 68℃, 30s

[0039] Number of cycles: 40

[0040] Extension: 68°C, 5min

[0041] 2.3 Result Analysis

[0042] The genomic DNA of 21 experimental materials was amplified with specific primers PALF / PALR, and sterile water was added as a template as a negative control. The amplified product is subjected to 2% agarose gel electrophoresis, and EB staining can observe the specific purpose size band, the fragment amplified by the universal primer should be about 262bp, and only the palmer amaranth shows the specific size purpose band (see figure 1 with figure 2 Middle 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to view more

Abstract

The invention relates to a method for detecting amaranthus palmeri in plants and plant products through the PCR technology, and belongs to the field of detection of poisonous and harmful weeds. According to the method, specific primers of amaranthus palmeri are designed, synthesized and used for specific detection of genome DNA of amaranthus palmeri. The molecular detection method for amaranthus palmeri is fast, easy and convenient to implement, high in specificity, accurate and reliable, and the whole detection process can be completed within one workday.

Description

technical field [0001] The invention relates to a method for detecting Palmer amaranth (Amaranthus palmeri S. Watson) in plants and plant products by using PCR technology, and belongs to the field of detection of toxic and harmful weeds. Background technique [0002] Amaranth (Amaranthus) belongs to Amaranthaceae (Amaranthaceae). It is an annual or biennial monoecious or dioecious herbaceous plant. There are nearly 70 species (including cultivars) of Amaranth in the world. The monoecious species in the genus Amaranthus are widely distributed, suitable for temperate, warm temperate, subtropical and tropical regions, and are one of the weed groups with the largest and most widely distributed biomass. Dioecious species are mainly distributed in North America, and appeared in Europe with human trade activities in the early 19th century. Weeds of the genus Amaranthus have caused certain harm to the ecosystem and agricultural production. Since the dioecious species (A. palmeri) ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895
Inventor 廖芳郭京泽姜一
Owner ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap