A method for detecting Palmer amaranth by using pcr primers
An amaranthus amaranthus, primer pair technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as indistinguishable, lack of basic technical data, etc. Strong, method-reliable results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Embodiment 1: Extraction of plant material genomic DNA
[0019] The seeds of Amaranthus in this experiment came from the Phytosanitary Laboratory of Animal, Plant and Food Center of Tianjin Entry-Exit Inspection and Quarantine Bureau. There are 21 species in total, and the relevant information is shown in Table 1.
[0020] Table 1 Code, Latin name, Chinese name and year of collection of test materials
[0021]
[0022]
[0023] Use sterilized tweezers to pick the plant seeds and put each amaranth seed into 1.5mL
[0024] Add 0.03 g of quartz sand to each tube, grind with liquid nitrogen, extract DNA according to the DNA extraction kit produced by QIAGEN, dissolve the DNA in 100 μL of 1×TE buffer, and store at -20°C.
Embodiment 2
[0025] Embodiment 2: the design of specific primer
[0026] The specific primers for the artificial synthesis of Palmer amaranth, the primer sequence is as follows:
[0027] PALF: TGGTACAGGTAGGGA AGA
[0028] PALR: ACATAAAATATTACAATCGACGCA
Embodiment 3
[0029] Embodiment 3: PCR amplification of Palmer amaranth specific primer
[0030] 1. Preparation of reaction mixture
[0031] The configuration of the reaction system is shown in Table 2.
[0032] Table 2 Amaranth specific amplification system
[0033]
[0034] 2. PCR reaction procedure
[0035] Pre-denaturation: 94°C, 3min
[0036] Denaturation: 94°C, 30s
[0037] Annealing: 57℃, 30s
[0038] Extension: 68℃, 30s
[0039] Number of cycles: 40
[0040] Extension: 68°C, 5min
[0041] 2.3 Result Analysis
[0042] The genomic DNA of 21 experimental materials was amplified with specific primers PALF / PALR, and sterile water was added as a template as a negative control. The amplified product is subjected to 2% agarose gel electrophoresis, and EB staining can observe the specific purpose size band, the fragment amplified by the universal primer should be about 262bp, and only the palmer amaranth shows the specific size purpose band (see figure 1 with figure 2 Middle 2...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap