Defensin-albumin anti-tumor fusion protein and preparation and application thereof

A technology of fusion protein and defensin, which is applied in the field of anti-tumor fusion protein, can solve the problems of non-immunogenicity and achieve remarkable therapeutic effect, good application prospect and good targeting effect

Active Publication Date: 2016-04-20
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The fusion protein has the characteristics of macropinocytosis targeting, defensin killing tumor cells, non-immunogenicity and resistance to drug resistance. So far, there have been no related reports at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Defensin-albumin anti-tumor fusion protein and preparation and application thereof
  • Defensin-albumin anti-tumor fusion protein and preparation and application thereof
  • Defensin-albumin anti-tumor fusion protein and preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] "Example 1" construction of recombinant expression vector pPIC9K-DIA

[0049] The amino acid sequences of the defensins HBD2 and HSA constituting DIA are from GenBank:

[0050] AAN64161.1 and CAA00047.1, processed by OptimumGeneTM codon optimization technology, were synthesized by Nanjing GenScript Co., Ltd. to provide plasmids PUC57s-HBD2 and PUC57s-HSA containing HBD2 and HSA coding genes. PCR primers used in molecular biology experiments were

[0051] Synthesized by InvitrogenTM Company, the plasmid pPIC9K was purchased from Invitrogen Company, and the Escherichia coli competent DH5α was a product of Beijing Quanshijin Biotechnology Company.

[0052] Primers for constructing recombinant pPIC9K-DIA:

[0053] β2F2:TCTG TACGTA GGTATTGGTGACCCTGTTACTTGTTTGAAGTCCGGTGCTATTTG54bp (the underline is the SnabI enzyme site)

[0054] β2R2: CTTGTGTGCATCGGAACCTC CACCTCCAGAACCTCCACCTCCAGGTTTCT TGCAACACT59bp (the underlined reverse complementary sequence is (G4S)2 connecting p...

Embodiment 2

[0062] 《Example 2》Induced expression, purification and identification of DIA

[0063] The GS115-DIA strain was induced and expressed on a small scale, and high-expression strains were screened out. The main steps are: pick the single colonies grown on the MD plate and inoculate them into BMGY medium (1% yeast extract, 2% peptone, 1.34% YNB, 4×10 -5 %biotin, 100mM pH6.0 potassium phosphate buffer, 1% glycerol), 28-30°C, 280-300rpm, cultivated to logarithmic phase (OD 600 =2-6). Transfer 0.5mL of culture solution to 50mL of BMGY medium (500mL shake flask, bottled at ≤10%), culture at 28-30°C, 280-300rpm, for 24-36h. Centrifuge at room temperature at 3,000×g for 5 minutes, discard the supernatant, collect the bacteria, and transfer the cell pellet to 50 mL of BMMY medium (1% yeast extract, 2% peptone, 1.34% YNB, 4×10 -5 % biotin, 100mM pH6.0 potassium phosphate buffer, 1% methanol), 28°C, 280-300rpm, cultured for 96h (100% methanol was added every 24h to a final concentration ...

Embodiment 3

[0064] "Example 3" Observation and quantification of DIA uptake by tumor cells through macropinocytosis

[0065] It has been reported that pancreatic cancer KRAS mutant MIAPaCa2 cells have significantly enhanced macropinocytosis compared with KRAS wild-type pancreatic cancer tumor cell BxPC-3. In this experiment, the pancreatic cancer cells MIAPaCa-2 and BxPC-3 in the logarithmic growth phase were made into cell suspensions, and the density was adjusted by counting the cells at 1×10 cells per well. 5 Cells were inoculated into a 12-well plate (with a sterilized round cover glass placed at the bottom of the plate), and routinely cultured until the cell confluency was about 70%. Aspirate and discard the culture medium, rinse twice with PBS, and incubate with FITC-labeled DIA protein or HSA protein (1mg / mL) at 37°C in the dark for 1-2h, and set the control group and the macropinocytosis inhibitor EIPA (amilor Pros: It is a specific inhibitor of macropinocytosis) group. Rinse wi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a defensin-albumin anti-tumor fusion protein comprising the following structure: defensin HBD2-connecting peptide (G4S) 2-human serum albumin HSA; wherein the human beta-defensin 2 (HBD2) has an amino acid sequence shown in SEQ ID NO: 1, the HAS has an amino acid sequence shown in SEQ ID NO: 2, the novel anti-tumor fusion protein has albumin macropinocytosis targeting property and the tumor cell killing function of the human beta-defensin 2 (HBD2), and is expected to be developed into a new class of anticancer drugs.

Description

Technical field: [0001] The invention belongs to the technical field of medicinal proteins, and in particular relates to a class of defensin-albumin anti-tumor fusion protein and its preparation and application. Background technique: [0002] Chemotherapeutic drugs are the main anti-tumor drugs commonly used in clinical practice, but due to their disadvantages such as low selectivity and large side effects, their application is subject to many restrictions; targeted anti-tumor drugs have high selectivity and low toxicity Great achievements have been made in treatment, but there are still many problems that affect the clinical treatment effect, such as low targeting efficiency, prone to tumor drug resistance, immune response and other safety issues. Therefore, continuing to find safer and more efficient anti-tumor targeted drugs is an important issue to be solved in the research and development of anti-tumor drugs. [0003] Macropinocytosis is a highly conserved form of endo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/81C12N1/19A61K38/17A61K47/48A61P35/00A61K47/64
Inventor杜玥甄永苏尚伯杨盛唯瑾李毅张胜华刘秀均
OwnerMEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI