Application of SPL18 gene in enhancing plant yield

A gene and plant technology, applied in the application field of SPL18 gene, can solve the problem of unknown function of OsSPL gene

Active Publication Date: 2016-06-01
ZHEJIANG UNIV
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the functions of many OsSPL genes in rice are still unknown, and a more in-depth and comprehensive study of these SPL genes is very important for discovering more genes regulating yield traits and cultivating high-yielding crops

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of SPL18 gene in enhancing plant yield
  • Application of SPL18 gene in enhancing plant yield
  • Application of SPL18 gene in enhancing plant yield

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Construction of Rice SPL18 Gene OsSPL18 Overexpression Vector

[0040] OsSPL18 gene expression box genome sequence (nucleotide sequence shown in SEQIDNO.5) acquisition: design PCR primers:

[0041] OsSPL18-geno-F (5'TGGTACCGATCTCACGTAAATACAATTCTCC) and OsSPL18-geno-R (5'CGGGTACCAATGATATATTTCTGCATAAGTTT) were amplified by PCR using the commercial rice variety Xiushui-134 genome as a template, including the putative OsSPL18 gene promoter, expression sequence and termination The size of the subsequence is a genome fragment of 7.4kb, and the sequence is shown in SEQ ID NO:5. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 7.5 minutes, repeating 33 cycles; and then 72°C for 10 minutes.

[0042] Construction of the Agrobacterium T-DNA vector: the binary vector pCambia1300-p35S-G10 vector (InternationalPat.No.PCT / CN2012 / 087069:SEQIDNO.47) contains a glyphosate-resistant gene (EPSPS) (as a marker gene for trans...

Embodiment 2

[0043] The construction of embodiment 2 rice SPL18 gene cDNA overexpression vector

[0044] 1. Cloning of cDNA

[0045] Cloning of rice OsSPL18 gene cDNA: PCR primers OsSPL18-CF (5'GGATCCAACAATGGATTGGGATCTCAAGATG) and OsSPL18-CR (5'GAGCTCCTACTGCCACGAGAATGGGAGCG) were designed, using the cDNA reverse-transcribed from the total RNA of inbred line 9311 as a template, and obtained by PCR amplification cDNA sequence of OsSPL18. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 90 seconds, repeating 33 cycles; and then 72°C for 10 minutes. The obtained PCR product of about 1.5 kb was cloned into the T-vector pMD19. Then, the corresponding cDNA (SEQ ID NO: 6) was obtained by double digestion with BamHI and SacI, and DNA sequence determination showed that the nucleotide sequence of the cDNA was correct. Then use pCambia1300 as a transition vector, double digest with BamHI and SacI to obtain the sequenced correct OsSPL18cDNA fra...

Embodiment 3

[0063] Embodiment 3, transformation of rice

[0064] The method of obtaining transgenic rice is to adopt the existing technology (Lu Xiongbin, Gong Zuxun (1998) Life Science 10: 125-131; Liu Fan et al. (2003) Molecular Plant Breeding 1: 108-115). The mature and plump seeds of "Xiushui-134" were dehulled, and callus was induced as transformation materials. Take the vectors constructed in Example 1 and Example 2 (pCambia1300-pOsSPL18-OsSPL18-p35S-pZmUbi-1174(geno);

[0065] pCambia1300-p35S-OsSPL18-pZmUbi-1174;

[0066] pCambia1300-pOsSPL18-OsSPL18-ter-p35S-pZmUbi-1174,

[0067] pCambia1300-pOsGA20ox1-OsSPL18-ter-p35S-pZmUbi-1174;

[0068] pCambia1300-pOsTEL-OsSPL18-ter-p35S-pZmUbi-1174;

[0069] Agrobacterium plating of pCambia1300-pOsARGOS-OsSPL18-ter-p35S-pZmUbi-1174). Pick a single colony to inoculate and prepare Agrobacterium for transformation. The callus to be transformed is put into the Agrobacterium bacterium liquid that OD is about 0.6 (preparation of Agrobacteri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of an SPL18 gene in enhancing plant yield. The SPL18 gene is derived from corn, rice, sorghum, wheat, barley, rye, millet, soybean, rape or sunflower. For the first time, the invention provides a method for enhancing grain number per spike or / and grain weight by promoting spike branching by using the SPL18 gene. The SPL gene is overexpressed in the crop, thereby effectively promoting spike branching, enhancing the grain number per spike or / and grain weight by 3% or above, and increasing the yield by 5% or above. The technique can effectively enhance the individual yield and yield per unit area, thereby enhancing the grain productivity and providing a new idea for national grain safety.

Description

(1) Technical field [0001] The invention relates to an application of the SPL18 gene, in particular to the application of regulating the grain number and grain weight per panicle of the crops and increasing the yield in crops such as rice, corn and wheat. (2) Background technology [0002] The continuous increase of population and the reduction of arable area must rely on increasing the yield of crops per unit area to meet human needs. Transgenic technology has been widely used to improve the traits of crops, such as acquiring insect resistance, herbicide resistance, enhancing drought resistance, and disease resistance. High yield is also an important content of transgenic crop improvement. For example, the yield of crops can be improved by transgenic expression of a plant transcription factor (U.S. Pat. No. 7,598,529,4). However, crop yield is a complex quantitative trait that is regulated by many genes (Xing and Zhang, (2010) Annual Review of Plant Biology, 61:421-442). ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82C12N15/29C07K14/415A01H5/00
Inventor张先文王东芳沈志成
OwnerZHEJIANG UNIV