Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Purification method of pseudomonas aeruginosa vaccine recombinant protein Vac11

A technology of Pseudomonas aeruginosa and purification method, which is applied in the field of separation and purification of Pseudomonas aeruginosa recombinant protein Vac11, which can solve the problems of reported and unseen purification methods of recombinant protein Vac11

Inactive Publication Date: 2016-06-08
ARMY MEDICAL UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on the purification method for the recombinant protein Vac11

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Purification method of pseudomonas aeruginosa vaccine recombinant protein Vac11
  • Purification method of pseudomonas aeruginosa vaccine recombinant protein Vac11
  • Purification method of pseudomonas aeruginosa vaccine recombinant protein Vac11

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1 Cloning of Vac11 Gene and Construction of Recombinant Plasmid pGEX-6P-2-Vac11

[0067] 1. According to the full-length gene sequence of AmpDh3 protein of Pseudomonas aeruginosa PA01, the bioinformatics software was used for structural analysis to determine the target gene fragment of Vac11 to be amplified.

[0068] 2. According to the analysis results, the PCR method was used to amplify the AmpDh3 target gene fragment from the PA01 genome, and the amplification steps were as follows:

[0069] 1) Design the PCR primers as follows, which are SEQ ID NO: 3-4 (the base sequence of the restriction site is underlined)

[0070] Seq ID

Primer name

Sequence (5'-3')

Endonuclease

Seq ID 3

Vac11-F

ATCGGATCCATGCTGACCATCGACT

Bam H I

Seq ID 4

Vac11-R

CCGGAATTCTCAGGCCGGGTATTTC

EcoR I

[0071] 2) Take out the preserved Pseudomonas aeruginosa strain PA01 from the freezer at -80°C and spread it on LB solid medi...

Embodiment 2

[0101] Example 2: Induced expression of recombinant fusion protein Vac11 in prokaryotic expression system-Escherichia coli and identification of its expression form

[0102] 1. Vac11 induced expression

[0103] Take 100 μL of the overnight cultured pGEX-6P-2-Vac11 / XL-1blue bacterial solution and add it to 10 mL of Amp+ resistant LB medium, culture overnight at 180 rpm at 37°C, take 400 μL of the overnight cultured bacterial solution and add it to 20 mL of Amp+ resistant LB medium (The rest of the bacterial solution is stored in a refrigerator at 4°C for later use), culture at 37°C for 2-3 hours, rotate at 200 rpm, and reactivate until the OD600 is 0.8-1.0, add 4 μL of IPTG to make the final concentration 200 μM, and place on a shaker Induced expression Induced expression at 30°C for 3h.

[0104] 2) Take out the bacterial solution after induced expression, centrifuge at 12000rpm for 5min, discard the supernatant, add 1mLlysisbuffer (20mMPB, pH7.2, 250mMNacl) to mix, ultrasonic...

Embodiment 3

[0111] Embodiment 3: Preparation of Vac11 antigen

[0112] 1. Amplify culture to obtain protein

[0113] Take 400 μL of the spare pGEX-6P-2-Vac11 / XL-1blue bacterial solution stored in the 4°C refrigerator and add it to 20mL LB medium containing Amp resistance for one activation. After culturing at 200rpm for 5-6 hours at 37°C, take 8mL once The activated bacterial solution was added to 400mL LB medium containing Amp resistance for secondary activation, cultured at 37°C for 3-4h until the OD600 was 1.0, then added 80μLPTG (final concentration 200μM) and placed in a shaker at 16°C overnight to induce Finally, 12000rpm was centrifuged for 15min to collect the thalli, and after adding 20mLlysisbuffer (same as Example 2) to resuspend the thallus, the bacterium liquid was subjected to ultrasonic cracking for 3min (200V), and the supernatant was collected and 800 μL of GlutathioneSepharose4B (GE Company) gel beads (beads) binding treatment; then SDS-PAGE gel electrophoresis.

[011...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a purification method of pseudomonas aeruginosa (PA) recombinant subunit genetic engineering vaccine protein Vac11. The protein is recombined and fused by the active functional fragments of pseudomonas aeruginosa antigen molecules and obtained through escherichia coli genetically engineered bacterium expression. High-pressure bacterium breaking, GST affinity chromatography, PP enzyme digestion, Q HP chromatography, G 25 chromatography, Q HP chromatography and the like are performed on genetically engineered bacteria to obtain the high-purity pseudomonas aeruginosa (PA) recombinant subunit genetic engineering vaccine protein Vac11. The purification method has the advantages that the method is simple in process, easy in amplification and good in repeatability, the obtained target protein is high in purity, and animal experiments prove that the protein can effectively stimulate a body to generate humoral immune response and is good in immune protection effect.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals, in particular to a method for separating and purifying the recombinant protein Vac11 (AmpDh3) of Pseudomonas aeruginosa (PA). Background technique [0002] Pseudomonas aeruginosa (PA), commonly known as Pseudomonas aeruginosa, is widely distributed in nature, normal human skin, intestinal tract, and respiratory tract. One of the pathogenic bacteria with the highest infection rate such as war wounds, and the death rate of systemic infection is more than 20%. [0003] At present, extensive research has been carried out on PA vaccines, but there are common problems such as single antigen type and low immune protection effect, and no vaccine has entered clinical application. AmpDh3 is a typical zinc protease of Pseudomonas aeruginosa, which is located in the periplasmic space of bacteria and plays an important role in the formation and remodeling of bacterial cell walls (LeeM et al., JAmChemSoc.201...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/52C07K1/22C07K1/16A61K39/104A61P31/04C12R1/385
CPCA61K39/104C12N9/52
Inventor 敬海明顾江邹全明章金勇孙红武付强牟道华张玉东徐丽敏
Owner ARMY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com