Check patentability & draft patents in minutes with Patsnap Eureka AI!

Mixed spidroin fiber preparing method

A technology of spidroin and fiber, which is applied in the field of preparation of mixed spidroin fibers, which can solve problems such as poor performance, low output, and inability to raise at high density

Active Publication Date: 2016-07-06
DONGHUA UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the large-scale mass production and bionic applications of spider silk still need to be strengthened, mainly for the following reasons: 1. Spiders are carnivorous animals, which are not easy to domesticate and cannot be raised in high density like silkworms; 2. The combination of natural spider silk 2. The silk forming mechanism and spinning process are extremely complex; 2. Using genetic engineering to express and produce recombinant spidroin in heterologous hosts is by far the most promising method
But this also faces difficulties, because the center of most spider silk proteins is a highly repetitive sequence, its molecular weight can reach more than 90%, and the repetitive region is rich in glycine and alanine
When expressing spider silk proteins with heterologous hosts, not only the problem of codon usage bias is faced, but this sequence characteristic also brings about the need for co-evolution of the library, and at the same time, this high content causes a special secondary structure and leads to gene recombination
Therefore, the produced spider silk protein reaches the size of natural spider silk protein, the yield is low, and the performance is far inferior to natural spider silk protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mixed spidroin fiber preparing method
  • Mixed spidroin fiber preparing method
  • Mixed spidroin fiber preparing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Take 1 μL of the MiSp genome of E. grandina, 2.5 μL of a pair of forward and reverse primers designed with the sequence of the NT gene, add 25 μL of Q5MasterMIX enzyme, and finally add 19 μL of ddH2O to mix well, and perform PCR amplification on the NT gene. The PCR conditions are denaturation at 98°C for 3 minutes, 65 Annealing at ℃ for 1 min, extension at 72°C for 10 min, a total of 35 cycles, PCR amplification of CT gene was carried out under the same conditions, NT forward primer: CGGGATCCCAACCAATCTGGACCAACCCA, reverse primer: CTGGTCTAGGTGCAGGTGCTGGAGCGTTTCCATAACCTGCTGCAGTG; CT forward primer: CTCTATCTCAACTGGCAGCACCGGTAGCTGCATATGGTGGCGCAGG, reverse primer: CCCTCGAGTTAACCTACATATTGGCCTACTGAATCCTGAAC then designed the forward and reverse primers based on the PySp repeat region of G. grandiferus. The length of the forward and reverse primers is 46 bp. Acid, the 23bp nucleotide after the reverse primer is forward complementary to CT. The PCR conditions were: denaturation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a mixed spidroin fiber preparing method.According to the method, the araneus ventricousus minor ampullate spidroin full-length coding gene and a piriform silk complete repetition area are taken as a template, splicing is conducted with the fusion PCR technique, connection with a pLX carrier is conducted, recombination quality construction is conducted, and expression is conducted in BL21.The degeneration purification means is adopted, and a mixed spidroin solution is obtained finally and stored after freeze-drying.Reaction conditions are mild, cost is low, the process is simple, and operation is easy.Prepared mixed spidroin fiber has high biocompatibility, uniform thickness and a smooth surface, and has potential application value in fields like biomedicine.

Description

technical field [0001] The invention belongs to the field of preparation of protein fibers, in particular to a method for preparing mixed spidroin fibers. Background technique [0002] Spider silk is a natural high-molecular-weight protein fiber with good mechanical properties and biological qualities, such as high strength, good elasticity, light texture, high and low temperature resistance, and good biocompatibility. The overall quality far exceeds that of silk And the artificially synthesized high-performance material fiber at this stage is a strategic resource that needs to be developed urgently, and has inestimable application value in the fields of biomedical engineering, aerospace and military. However, the large-scale mass production and bionic applications of spider silk still need to be strengthened, mainly for the following reasons: 1. Spiders are carnivorous animals, which are not easy to domesticate and cannot be raised in high density like silkworms; 2. The com...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/62C12N15/70C07K19/00
CPCC07K14/43518C07K2319/00C12N15/70C12N2800/101
Inventor 吴忠笏孟清
Owner DONGHUA UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More