Mixed spidroin fiber preparing method
A technology of spidroin and fiber, which is applied in the field of preparation of mixed spidroin fibers, which can solve problems such as poor performance, low output, and inability to raise at high density
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Take 1 μL of the MiSp genome of E. grandina, 2.5 μL of a pair of forward and reverse primers designed with the sequence of the NT gene, add 25 μL of Q5MasterMIX enzyme, and finally add 19 μL of ddH2O to mix well, and perform PCR amplification on the NT gene. The PCR conditions are denaturation at 98°C for 3 minutes, 65 Annealing at ℃ for 1 min, extension at 72°C for 10 min, a total of 35 cycles, PCR amplification of CT gene was carried out under the same conditions, NT forward primer: CGGGATCCCAACCAATCTGGACCAACCCA, reverse primer: CTGGTCTAGGTGCAGGTGCTGGAGCGTTTCCATAACCTGCTGCAGTG; CT forward primer: CTCTATCTCAACTGGCAGCACCGGTAGCTGCATATGGTGGCGCAGG, reverse primer: CCCTCGAGTTAACCTACATATTGGCCTACTGAATCCTGAAC then designed the forward and reverse primers based on the PySp repeat region of G. grandiferus. The length of the forward and reverse primers is 46 bp. Acid, the 23bp nucleotide after the reverse primer is forward complementary to CT. The PCR conditions were: denaturation...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com