Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for rapidly and seamlessly assembling DNA in vitro on basis of heat-proof DNA polymerase and ligase

A technology of DNA ligase and polymerase, applied in the field of genetic engineering, can solve the problems of increased cost, complexity, and time-consuming of primer synthesis, and achieve the effect of rapid directed evolution and synthetic biology operations

Active Publication Date: 2016-07-27
JIANGNAN UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the long homologous regions required, the cost of primer synthesis is greatly increased, especially for the construction of non-Saccharomyces cerevisiae pathways, which is more complicated and time-consuming (up to 10-15 days)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly and seamlessly assembling DNA in vitro on basis of heat-proof DNA polymerase and ligase
  • Method for rapidly and seamlessly assembling DNA in vitro on basis of heat-proof DNA polymerase and ligase
  • Method for rapidly and seamlessly assembling DNA in vitro on basis of heat-proof DNA polymerase and ligase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1 is optimized to the reaction system of DATEL assembly technology

[0044] Taking the green fluorescent protein gene gfp and pUC19 vectors as examples, the assembly reaction was optimized. First, optimize the length of the "homologous arm" of the assembly reaction and the cutting reaction time, and design 6 sets of gfp amplification primers with 20bp, 30bp, 40bp, 50bp, 60bp and 70bp homology arms according to the gfp fragment and the carrier sequence, respectively, And a pair of vector pUC19 amplification primers. Primers are as follows:

[0045] TEL / puc19-F: TTCTTCTCCCTTACCCATGGCGTAATCATGGTCATAGCTGTTTCCT

[0046] TEL / puc19-R: TGGATGAACTATACAAATAACTGGCCGTCGTTTTACAACGTCG

[0047] TEL / gfp-P20F: CCATGGGTAAGGGAGAAGAACTTTTCAC

[0048] TEL / gfp-P20R: TTATTTGTATAGTTCATCCATGCC

[0049] TEL / gfp-P30F: CATGATTACGCCATGGGTAAGGGAGAAGAA

[0050] TEL / gfp-P30R: CGACGGCCAGTTATTTGTATAGTTCATCCA

[0051] TEL / gfp-P40F: CAGCTATGACCATGATTACGCCATGGGTAAGGGAGAAGAA

[0052] TEL / ...

Embodiment 2

[0063] Embodiment 2 uses DATEL to quickly assemble multiple fragments

[0064] In order to verify the efficiency and accuracy of DATEL assembly of multiple fragments, the constitutive promoter PrpoS of the rpoS gene of Escherichia coli, the esterase gene estC23, the green fluorescent protein gene gfp, the kanamycin gene kan and the pbluesscriptIISK(+) vector were taken as examples , for assembly of 3-5 fragments ( Figure 4 a). All primers were first phosphorylated. The primer information is as follows:

[0065] MFA / pSK-R: GGTAATGGCAGTCGTGACTGGGAAAACCCTGGCGTTAC

[0066] MFA / pSK-4F:CTCGATGAGTTCTTCTAACCTGTGTGAAATTGTTATCCGCTCAC

[0067] MFA / pSK-3F: GTTCATCCGCGCCAACGCCGAGTAACCTGTGTGAAATTGTTATCCGCTCAC

[0068] MFA / pSK-2F:ATTACACATGGCATGGACGAACTATACAAATAACCTGTGTGAAATTGTTATCCGCTCAC

[0069] MFA / Prpos-F: AGGGTTTTTCCCAGTCACGACTGCCATTACCCAGGCCGACGCAGC

[0070] MFA / Prpos-R:CTTCTCCCCTTACCCCATAAGGTGGCTCCTACCCGTGATC

[0071] MFA / gfp-F:GTAGGAGCCACCTTATGGGTAAGGGAGAAGAACTTTTCAC

[007...

Embodiment 3

[0079] Example 3 Application of DATEL to quickly construct a combinatorial library of β-carotene synthesis pathway

[0080] In order to verify the assembly ability of multiple fragments of DATEL, the crtEXYIB of the β-carotene synthesis gene cluster derived from Pantoea agglomerans was used for assembly application. The gene cluster is divided into five DNA segments crtE, crtX, crtY, crtI and crtB (such as Figure 5 shown), and designed and assembled into the vector pUC19 according to this sequence. In particular, as a significant functional application of the DATEL scarless assembly technology (combinatorial assembly of modified proteins and mutations in metabolic pathways), the RBS sequence in each upstream forward primer was degenerately designed, and PCR amplified using this primer Upstream of each gene fragment is an RBS library with extremely rich diversity (protein translation intensity). The primer information of this embodiment is as follows:

[0081] CPA / puc19-F: ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapidly and seamlessly assembling DNA in vitro on the basis of heat-proof DNA polymerase and ligase and belongs to the technical field of genetic engineering. Homologous arm sequences are introduced to two tail ends of a target fragment required to be assembled and constructed, and DNA is rapidly assembled and constructed in vitro in a denaturation-annealing-cutting-connection manner by the aid of thermal cycle. 2-6 fragments can be efficiently, rapidly and seamlessly assembled once in 2 h. Besides, a mutation sequence is introduced and merged into a primer for PCR amplification, DNA fragments containing different mutation regions are obtained, and assembling mutation construction of gene DNA is realized with the assembling method. The method can be used for conventional DNA recombination and construction, realizes high-throughput operation and is particularly suitable for in-vitro efficient evolution modification of enzyme genes and synthesis ways, and rich combined mutation diversity is introduced for biological operation of rapid directional evolution and synthesis.

Description

technical field [0001] The invention relates to a method for rapidly and seamlessly assembling DNA in vitro based on heat-resistant DNA polymerase and ligase, and belongs to the technical field of genetic engineering. Background technique [0002] The remarkable achievement in the field of molecular biology in the last century was the discovery of restriction endonuclease and DNA ligase, which established the basic technology for DNA recombination in vitro. Recombinant DNA technology has greatly promoted people's understanding of the structure and function of genes, and laid the foundation for the rapid development of enzyme engineering, metabolic engineering and synthetic biology. However, in the actual operation process, due to the limitation of restriction enzyme sites, the recombination construction of DNA fragments, especially the assembly construction of multiple fragments, the traditional conventional enzyme digestion and ligation technology appears to be stretched. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10
CPCC12N15/1024C12Q2521/501C12Q2521/101C12Q2531/113
Inventor 康振陈坚金鹏堵国成丁雯雯
Owner JIANGNAN UNIV