LAMP method for detecting enterobacteriaceae food-borne pathogenic bacteria, nucleic acid and primer pairs

A technology for the detection of food-borne pathogenic bacteria and Enterobacteriaceae, which is applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., and can solve problems such as low counting results, high counting results, and long detection cycles , to achieve accurate and reliable results, low detection cost and fast detection speed

Active Publication Date: 2016-07-27
杭州海关技术中心
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The method of ISO21528-1:2004 and SN0738-1997 to detect Enterobacteriaceae is to count MPN, and GB / T4789.31-2003 formulated the phage detection method of Enterobacteriaceae, but in view of the fact that the industry standard needs to count the phages on the VRBGA plate Colonies undergo glucose fermentation and oxidase confirmation tests, and need to prepare medium and prepare sterilized plates. After plate culture, manual counting is required, which may cause errors such as missed detection.
It is relatively difficult for some laboratories to prepare phages in the national standard
The NMKL method only confirms Enterobacteriaceae with negative oxidase. This method can misjudge Acinetobacter wolfii, which does not ferment glucose but can grow with peptone and is also negative for oxidase, as Enterobacteriaceae, resulting in false positives. As a result, the counting result is high; the ISO method is positive for Enterobacteriaceae by oxidase negative and yellow glucose agar, this rule is easy to turn the surface of glucose agar into blue Enterobacter cloacae, Enterobacter aerogenes and Serratia Bacteria missed detection, false negatives occur, resulting in low count results, and these methods have a long detection cycle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP method for detecting enterobacteriaceae food-borne pathogenic bacteria, nucleic acid and primer pairs
  • LAMP method for detecting enterobacteriaceae food-borne pathogenic bacteria, nucleic acid and primer pairs
  • LAMP method for detecting enterobacteriaceae food-borne pathogenic bacteria, nucleic acid and primer pairs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1: Enterobacteriaceae PCR detection method specifically comprises the following steps:

[0022] Step 1, designing primers according to the conserved sequences in the genomic DNA sequences of Enterobacteriaceae;

[0023] Through comparative genome and bioinformatics analysis, a specific DNA sequence was found in the Enterobacteriaceae genome DNA sequence, and it was used as a detection target for Enterobacteriaceae. The base sequence of the nucleic acid is:

[0024] 5’—GCCTTTGTGCATTTTACGGAATTTTGTACGCTTTGGTTGTAACATCAGCGACGCTCCTTATTTACGGCCTTTACGCTGCTGCTTTTTCGGTTGAGCAGCCGGTTTTTCCGGTTGTTCAACAGCAGCCATACCACCCAGGATCTCGCCTTTGAAGATCCACACTTTAACGCCGATTACACCATAAGTGGTGTGCGCTTCAGAGGTGTTGTAGTCGATGTCAGCACGCAGAGTGTGCAGAGGTACGCGACCTTCGCGGTACCATTCGGTACGTGCGATTTCCGCGCCGCCCAGACGGCCGCTAACTTCAACTTTGATACCTTTAGCGCCCAGACGCATGGCGTTCTGTACAGCACGCTTCATCGCACGACGGAACATCACGCGACGTTCCAGCTGAGAAGTGATGCTGTCAGCAACCAGTTTAGCGTCCAGTTCAGGTTTACGAACTTCGGCGATATTGATCTGTGCAGGAACGCCAGCGATATCCGCTACGACCTTACGCA—...

Embodiment 2

[0044] Example 2: Using the detection method in Example 1, 30 isolated strains from food samples were detected. For sample processing and strain isolation and identification, refer to the national standard GB / T4789.4-2010. The results showed that the LAMP detection was consistent with the identification of the national standard method (as shown in Table 2).

[0045] Table 2 The isolated strains used for detection

[0046]

[0047]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an LAMP method for detecting enterobacteriaceae food-borne pathogenic bacteria, nucleic acid and primer pairs and belongs to the technical field of food safety detection.The LAMP method includes the following steps that a common gene sequence of the enterobacteriaceae pathogenic bacteria is screened out through bioinformatics and comparative genomics, and the specific amplification primer pairs are designed according to the sequence; an LAMP detection system is established by optimizing reaction conditions.The invention further relates to nucleic acid with the base sequence shown in SEQ ID NO:1 and a group (three pairs) of primers.The base sequences of the primers are shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.Compared with the prior art, the detection method is used for detecting enterobacteriaceae, detection time is short, cost is low, higher practicality is achieved, the detection result is specific, and result judgment is simple.

Description

technical field [0001] The invention relates to the technical field of food safety detection, in particular to a LAMP method for detecting enterobacteriaceae food-borne pathogenic bacteria, a nucleic acid and a primer pair. Background technique [0002] Enterobacteriaceae (Enterobacteriaceae) is defined in "Bergey's Bacterial System Identification Manual" as a large group of Gram-negative non-bacillus bacteria with similar biological characteristics that widely exist in the intestinal tract of humans and animals and in nature. Such bacteria can form obvious colonies on VRBGA agar at 30°C±1°C or 37°C±1°C and can ferment glucose, oxidase-negative bacteria. "Bergey's Handbook of Systematic Bacteriology (2004 Edition)" divides Enterobacteriaceae bacteria into 44 genera and more than 170 species. Enterobacteriaceae now includes bacteria in the coliform group, as well as the pathogenic genera Salmonella, Shigella, Klebsiella, Proteus, and Enterobacter in addition to the coliform ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6844C12Q1/689C12Q2531/119Y02A50/30
Inventor李可顿玉慧方莹杨兰花陆金虎卢力
Owner杭州海关技术中心