Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for detecting microRNA content by using single-stranded specific nuclease

An enzyme detection, single-strand technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of increased false positive rate of diagnostic results and reduced hybridization stringency

Inactive Publication Date: 2016-11-16
SHENZHEN PEOPLES HOSPITAL
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the ultra-small size of microRNA reduces the stringency of hybridization between the probe and the target microRNA on the chip; and the base mismatch or partial complementarity generated during the hybridization process will increase the false positive rate of diagnostic results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting microRNA content by using single-stranded specific nuclease
  • Method for detecting microRNA content by using single-stranded specific nuclease
  • Method for detecting microRNA content by using single-stranded specific nuclease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1, the method of using SSSN enzyme to detect whether the sample to be tested contains microRNA let-7a

[0053] figure 1 It is a flowchart of microRNA detection using SSSN enzyme.

[0054] In the following examples, microRNA let-7a is used as the microRNA to be detected, and the nucleotide sequence of microRNA let-7a is UGAGGUAGUAGGUUGUAUAGUU (sequence 2).

[0055] 1. Samples to be tested

[0056] The embodiment of the present invention adopts the microRNA let-7a solution with a concentration of 0.5fM to 1000fM as the sample to be tested;

[0057] The solute in the above solution is microRNA let-7a, and the solvent is a PBS buffer solution (8g NaCl, 0.2g KCl, 1.44g Na 2 HPO 4 and 0.24g KH 2 PO 4 , dissolved in 1000ml of water).

[0058] The sample to be tested in the present invention can also be derived from plasma or serum, and the RNA of plasma or serum needs to be extracted. The specific method is as follows: the plasma or serum sample is diluted to...

Embodiment 2

[0089] Embodiment 2, the method that utilizes SSSN enzyme to detect microRNA let-7a content in the sample to be tested

[0090] 1. Samples and standards to be tested

[0091] Standards with different concentrations are microRNAlet-7a solutions with concentrations of 0.5fM, 1fM, 5fM, 50fM, 500fM, and 1000fM;

[0092] The samples to be tested are microRNA let-7a solution with a concentration of 10fM and microRNA let-7a solution with a concentration of 100fM.

[0093]The solute in the above solution is microRNA let-7a, and the solvent is a PBS buffer solution (8g NaCl, 0.2g KCl, 1.44g Na 2 HPO 4 and 0.24g KH 2 PO 4 , dissolved in 1000ml of water).

[0094] 2. Method for high-throughput detection of microRNA let-7a content using SSSN enzyme

[0095] 1. MicroRNA let-7a probe preparation

[0096] Same as Example 1.

[0097] 2. Obtaining the microtiter plate after the reaction

[0098] 1) Microtiter plate for connecting probes

[0099] Same as Example 1.

[0100] 2) ELISA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting microRNA by using single-stranded specific nuclease, and provides a method for detecting whether a sample to be detected contains target microRNA or not by using SSSN enzyme. The method comprises the following steps: (1) preparing a target microRNA probe, wherein the target microRNA probe is NH2-A-B-biotin, A is (CH2)n, n is an integer from 6 to 12, and B is single-stranded DNA molecules which reversely complement with the target microRNA; (2) successively adding the target microRNA probe, the sample to be detected and the SSSN enzyme in various holes of an elisa plate to obtain a reacted elisa plate; and (3) detecting the reacted elisa plate by a chemiluminescence method, and judging whether the sample to be detected contains the target microRNA or not. Experiments prove that by the method, sensitivity and specificity of a whole detecting system can be improved, and accuracy and reliability of detection results are ensured.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for detecting microRNA content by using single-strand specific nuclease (Single-Strand Specific Nuclease, SSSN). Background technique [0002] The ultra-small size of microRNA and the ultra-low concentration in body fluids make many excellent detection technologies "helpless" to it. Recently, microRNA chip technology based on nucleic acid hybridization has been greatly developed because it can realize rapid and high-throughput microRNA detection. However, the ultra-small size of microRNA reduces the stringency of hybridization between the probe and the target microRNA on the chip; and the base mismatch or partial complementarity generated during the hybridization process will increase the false positive rate of diagnostic results. [0003] SSSN enzymes are a class of single-stranded specific nucleases that highly selectively excise single-stranded nucleic acids or single-st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/34C12N15/11
CPCC12Q1/6834C12Q1/6876C12Q2600/178C12Q2521/307C12Q2563/107C12Q2565/101
Inventor 李富荣凌凯
Owner SHENZHEN PEOPLES HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com