Method for eliminating mecA plasmids based on CRISPR/Cas9 technology

A t-pmd19-meca, plasmid technology, applied in the field of molecular biology, can solve the problems of limited development, not widespread, and poor effect of Staphylococcus aureus

Inactive Publication Date: 2016-11-30
ZHENGZHOU UNIV
View PDF1 Cites 37 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the research of new drugs against MRSA mainly has the following methods. One is to modify the structure on the basis of the original antibiotics to explore new antibiotics. For example, telavancin (telavancin) is a vancomycin derivative formed through the transformation of vancomycin. , and has good antibacterial activity against MRSA, but it is not widely used due to its poor effect on vancomycin-resistant S. The antibacterial protein developed by the good antibacterial effect of this method has obvious effect and high specificity, but as a macromolecular protein, its metabolic half-life in vivo and its immunogenicity limit its development.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for eliminating mecA plasmids based on CRISPR/Cas9 technology
  • Method for eliminating mecA plasmids based on CRISPR/Cas9 technology
  • Method for eliminating mecA plasmids based on CRISPR/Cas9 technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0059] The features of the present invention and other relevant features are described in further detail below through the embodiments, so as to facilitate the understanding of those skilled in the art:

[0060] The CRISPR / Cas9 technology provided by the present invention eliminates mecA The method for the plasmid comprises the following steps:

[0061] (1) DNA template preparation

[0062] DNA was extracted from MRSA mel-stap-a2014124 / zz strain using bacterial genomic DNA extraction kit;

[0063] (2) mecA Gene PCR amplification

[0064] Selection of MRSA strain pairs mecA The DNA sequence encoding the C-terminus of transpeptidase is amplified by PCR;

[0065] Among them, the amplification primers are:

[0066] F: CGGGATCCACTATTGATGCTAAAGTTCAAAAG

[0067] R:CCCAAGCTTATCATCTATATCGTATTTTTTATTA;

[0068] The PCR amplification system includes: 12.5 μl of 2×Taq PCR Master Mix, 1 μl of amplification primer F, 1 μl of amplification primer R, 2 μl of MRSA DNA, and 8.5 μl of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for eliminating mecA plasmids based on CRISPR / Cas9 technology. The method comprises: selecting an MRSA strain to perform PCR amplification to a DNA sequence of a C terminal of mecA gene coding transpeptidase; carrying out gel extraction for mecA genes; connecting the mecA genes with a T-pMD19 (simple) carrier and preparing DH5[alpha] competent cells; electro-transforming the DH5[alpha] competent cells through the obtained T-pMD19-mecA plasmids; extracting the T-pMD19-mecA plasmids and performing sequencing and verification; performing double digestion treatment for the T-pMD19-mecA plasmids and performing gel extraction to the mecA genes; connecting pET-21a (+) plasmids with the mecA genes; designing and synthesizing oligos; constructing pCas9 :: mecA plasmids; electro-transforming the obtained pET-21a (+)-mecA plasmids into an escherichia coli expression strain BL21 (D3); and electro-transforming the pCas9 :: mecA plasmids and the pCas9 plasmids into BL21 (D3)+pET-21a(+)-mecA competent bacteria and BL21 (D3)+pET-21a(+) competent bacteria. The method is simple to operate and good in specificity, and can effectively block spread of mecA to eliminating the mecA strain.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a technology based on CRISPR / Cas9 to eliminate mecA Plasmid method. Background technique [0002] Staphylococcus aureus is one of the main pathogens causing a series of human infectious diseases, referred to as Staphylococcus aureus, can cause skin infection, severe pneumonia, endocarditis, joint suppurative inflammation, and food poisoning, severe cases can cause severe Toxic shock syndrome can easily lead to death of patients. Among them, methicillin-resistant Staphylococcus aureus (methicillin-resistant Staphylococcμ s aμ reμ s , MRSA) has become an important pathogen in hospital and hospital infection and drug resistance monitoring because of its more serious drug resistance. A key reason for MRSA's drug resistance is mecA Gene. mecA The gene is present on the mobile element cassette chromosome of Staphylococcus ( Staphylococcal Cassette Chromosome mec , ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N15/66
CPCC12N15/66C12N15/70C12N2800/101
Inventor杨海燕杨似玉段广才
OwnerZHENGZHOU UNIV