Method of immobilizing enzyme by means of coordination of graphene oxide and metal ions

A technology of metal ions and immobilized enzymes, which is applied in the direction of immobilization on or in the inorganic carrier, can solve the problems of low loading capacity, low immobilization rate, poor stability and reusability of immobilized enzymes, and achieve a high loading area Effects of large size, high immobilization rate, pH stability, and enhanced stability for repeated use

Active Publication Date: 2016-12-07
XIAMEN UNIV
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current use of graphene oxide as an enzyme immobilization carrier still has some defects such as low loading capacity, low immobilization rate, poor stability and reusability of immobilized enzymes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of immobilizing enzyme by means of coordination of graphene oxide and metal ions
  • Method of immobilizing enzyme by means of coordination of graphene oxide and metal ions
  • Method of immobilizing enzyme by means of coordination of graphene oxide and metal ions

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1) Preparation of crude enzyme solution:

[0037] Construction of a recombinant expression strain that can express the target enzyme with the His-tag tag: the original sequence of the gene of formate dehydrogenase (FDH) comes from Candida boidinii (190-1284nucleotide, Genebank ID: AF004096.1), as shown in SEQ ID NO.1 ; According to the above-mentioned original sequence, design primers (as shown in table 1) and adopt PCR method to construct the formate dehydrogenase gene that 5 ' end and 3 ' end respectively have NdeI and Xhol restriction site, PCR synthetic process is by Shanghai Sheng Gong Biological Engineering Technology Service Co., Ltd. completed:

[0038] Table 1 Primers used for FDH gene amplification

[0039] Primer name

Corresponds to the number in the sequence listing

Sequence (5'-3')

FDH-P1

SEQ ID NO.2

GGAATTC CATATG AAAATTGTCCTGGTCCTGT

FDH-P2

SEQ ID NO.3

CCG CTCGAG TTACTTTTTTATCGTGTTTGCCAT

[0040] A...

Embodiment 2

[0052] 1)-4) The experimental steps are as the steps 1)-4) of Example 1.

[0053] 5) Preparation of graphene oxide-metal ion immobilized carrier: adding ZnCl to the graphene oxide solution 2 Solution, so that the final concentration after coordination equilibrium in the solution is 10 mM: shake in a constant temperature oscillator (4° C., 1 h), and obtain a graphene oxide-metal ion suspension.

[0054] 6) Preparation of graphene oxide-metal coordination-immobilized enzyme: in the graphene oxide-metal ion suspension obtained in step 5), add the formate dehydrogenase solution obtained in step 2) and make its final concentration 10 mg / mL, shake in a constant temperature shaker (4°C, 1h) to form immobilized particles, wash with pure water three times and resuspend with Tris-HCl buffer solution (0.1M, pH 10) to obtain immobilized enzyme GO-Zn- FDH, the recovery rate of enzyme activity can reach 84.28%. Figure 6 shown.

[0055] 7) Determination of the temperature stability of t...

Embodiment 3

[0058] 1)-4) The experimental steps are as the steps 1)-4) of Example 1.

[0059] 5) Preparation of graphene oxide-metal ion immobilized carrier: adding MgCl to the graphene oxide solution 2 Solution, so that the final concentration after coordination equilibrium in the solution is 0.1 mM: shake in a constant temperature oscillator (4° C., 1 h), and obtain a graphene oxide-metal ion suspension.

[0060] 6) Preparation of graphene oxide-metal coordination immobilized enzyme: add the formate dehydrogenase solution obtained in step 2) to the graphene oxide-metal ion suspension obtained in step 5) and make the final concentration 0.1mg / mL, shake in a constant temperature shaker (4°C, 1h) to form immobilized particles, wash with pure water three times and resuspend with Tris-HCl buffer solution (0.05M, pH 11.5) to obtain the immobilized enzyme GO-Mg -FDH, the recovery rate of enzyme activity can reach 83.10%. Figure 9 shown.

[0061] 7) Determination of the temperature stabili...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method of immobilizing enzyme by means of coordination of graphene oxide and metal ions and belongs to the technical field of enzyme immobilization. In the immobilization, transition-state metal ions are coordinated with a carboxyl group on the graphene oxide, and through the coordination, formate dehydrogenase is immobilized. The graphene oxide in a lamellar structure is an excellent immobilization carrier, of which the surface has functional groups, such as epoxy groups, carbonyl groups, carboxyl groups and the like, so that the carrier is large in support area. Through the coordination effect of the metal ions, the graphene oxide is uniformly dispersed and support load of the enzyme is increased. In addition, through a coordination interaction with a histidine label of the enzyme, the enzyme is immobilized on the graphene oxide. The method is simple in processes, has mild preparation conditions and high immobilization rate. The immobilized enzyme is significantly improved in temperature stability, pH stability and repeatedly usage stability, and is high in enzyme activity recovery rate.

Description

technical field [0001] The invention relates to a method for using graphene oxide-metal ion coordination and immobilization of enzymes, belonging to the field of enzyme immobilization. Background technique [0002] In the process of oxidoreductase catalysis, the regeneration of coenzyme is very important, and the application of formate dehydrogenase (FDH) in the regeneration of coenzyme has become one of the research hotspots. Formate dehydrogenase can be used to construct efficient coenzyme regeneration system and has been applied in industrial production. The advantage is that the product is CO 2 It is easy to escape from the reaction system, make the reaction proceed in the positive direction, and facilitate the separation and detection of products. The substrate sodium formate or ammonium formate is cheap, which can reduce the cost. [0003] Due to the poor stability of free formate dehydrogenase, it can be improved by immobilization. The immobilized enzyme can be re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N11/14
CPCC12N11/14
Inventor王世珍方柏山林鹏
OwnerXIAMEN UNIV