Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for expressing and purifying silkworm ecdyson receptor EcR/USP protein compound

An ecdysone receptor and complex technology, which is applied in the preparation methods of hormone receptors and peptides, receptors/cell surface antigens/cell surface determinants, etc., can solve the problem of no Bombyx mori EcR/USP protein complex expression and purification. methods, etc.

Inactive Publication Date: 2016-12-07
CHINA PHARM UNIV +1
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no method for the expression and purification of the silkworm EcR / USP protein complex

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing and purifying silkworm ecdyson receptor EcR/USP protein compound
  • Method for expressing and purifying silkworm ecdyson receptor EcR/USP protein compound
  • Method for expressing and purifying silkworm ecdyson receptor EcR/USP protein compound

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0100] Example 1: USP-pET-28a(+), EcR-pET21b-MDX12 recombinant vector construction

[0101]

[0102] (1) Primer design

[0103] Amplify the USP gene, the gene sequence is shown in SEQ ID NO.1, and the primers are designed as follows:

[0104] Upstream primer F: 5' CCG GAATTC ATGCATCCCAGCAGCTCTGTAC 3' (the underlined part is the restriction endonuclease EcoR Ⅰ restriction site)

[0105] Downstream primer R: 5'GGG TTCGAA GGCCTTAAGTTACATGATGTTGG 3' (the underlined part is the restriction endonuclease Hind III restriction site)

[0106] (2) Construction of recombinant vector

[0107] Using the silkworm USP as a template, use the designed primers F and R to amplify the specific fragment. The specific procedure is as follows:

[0108]

[0109] Finally, the gel is recovered to obtain the product USP gene (see figure 1 );

[0110] (3) In the PCR tube, add the following components

[0111]

[0112] After each component is mixed evenly, put it into the PCR instrument, ...

Embodiment 2

[0131] Embodiment 2: Recombinant protein expression test

[0132] Transform the constructed recombinant plasmid USP-pET-28a(+) into E.coli BL21(DE3), plysS, Rossetta(DE3) (all made by the laboratory) host strains competent, 1μl of the plasmid transforms 100μl of the competent State cells, ice bath for 30min, heat shock for 90s, ice bath for 2min, add 500μl LB medium (without anti-antibody), shake at 250rpm for 1h at 37℃, take 50μl plate (50μg / ml kanamycin), and incubate at 37℃ box overnight to obtain the recombinant bacteria;

[0133] The next day, CaCl 2 Prepare USP-pET-28a(+)in E.coli BL21(DE3), plysS, Rossetta(DE3) competent. Pick a single clone separately, shake overnight at 37°C and 250rpm in 5ml LB medium containing 50μg / ml kanamycin; take 100μl of the culture solution, transfer to 100ml LB containing antibiotics, and cultivate to OD at 37°C and 250rpm 600 to 0.4; transfer the bacterial solution to a 50ml EP tube, place on ice for 10min; centrifuge at 4000rpm for 10mi...

Embodiment 3

[0136] Example 3 Expanded expression and purification of recombinant protein

[0137] Take 100 μl of seed liquid, transfer to 100 ml of LB containing antibiotics (final concentration of 50 μg / ml ampicillin and 50 μg / ml kanamycin), and culture overnight at 37° C. and 250 rpm. The next day, take 20ml of the culture solution and add it to 2L of antibiotic-containing LB medium (1% inoculation, containing a final concentration of 50μg / ml ampicillin and 50μg / ml kanamycin), and culture at 37°C and 180rpm until OD 600 After 0.6, 0.3mM IPTG was induced overnight at 16°C. Harvest the bacteria, centrifuge at 4°C, 5000rpm, 10min, discard the supernatant, and collect the bacteria;

[0138] The cells were resuspended with 10 times the volume of lysis buffer (50 mM Tris-HCl, 300 mM NaCl, 10% Glycerol, pH 8.0), and sonicated by a sonicator for 30 min, ultra-sonicated for 3 s, with an interval of 6 s, and a power of 400 W. Centrifuge at 12000rpm at 4°C for 30min, and the supernatant after ce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for expressing and purifying a silkworm ecdyson receptor EcR / USP protein compound. The method comprises the following steps: constructing a USP-pET-28a (+) recombinant vector and an EcR-pET21b-MDX12 recombinant vector; converting the USP-pET-28a (+) recombinant vector and the EcR-pET21b-MDX12 recombinant vector into an expression strain, culturing, and carrying out inducible expression to obtain a recombinant target compound; and purifying the obtained recombinant target compound through nickel ion affinity chromatography and molecular sieve chromatography. The recombinant expression vector EcR-pET21b-MDX12 and USP-pET-28a (+) are constructed, and are co-converted to induce co-expression of two proteins in order to obtain a large amount of the recombinant target protein compound, and the recombinant target protein compound undergoes nickel ion affinity chromatography column and molecular sieve separation and purification in order to obtain the highly-pure target protein.

Description

technical field [0001] The invention relates to the expression and purification method of silkworm ecdysterod receptor (ecdysterod receptor, EcR) and ultraspiracle (ultraspiracle, USP) protein complex. Background technique [0002] The morphological change process of insects from larvae to adults is called metamorphosis (Metamorphosis). Silkworms are insects that undergo complete metamorphosis. During the development of silkworms, they have to go through four developmental stages: egg, larva, pupa, and adult (moth) to complete life. cycle. During the growth and development of silkworms, it takes several molts to mature. The molting process of silkworms includes: embryonic hatching molting, larval molting at various ages, and molting from larva to pupa and pupa to adult. The molting and metamorphosis of silkworms are mainly controlled by the ecdysone in the body. 20-hydroxyecdysone (20E) is a steroidal ecdysone secreted by arthropods including insects and crustaceans. It p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C07K14/72C07K1/22C07K1/16
Inventor 吴桃利王涛汪俊陈春麟
Owner CHINA PHARM UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com