Primer pair for identifying chicken parvovirus and application thereof

A technology for chicken parvovirus and primer pair, which is applied to the primer pair for identifying chicken parvovirus and its application field, can solve the problems of time-consuming and labor-intensive sensitivity and low level, and achieve the effects of high practical value, pollution reduction and cost saving.

Inactive Publication Date: 2016-12-07
GUANGXI VETERINARY RES INST
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the methods for identifying viruses mainly rely on traditional virus isolation, agar diffusion test and ELISA, etc., but these methods usually have the disadvantages of time-consuming, laborious and low sensitivity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair for identifying chicken parvovirus and application thereof
  • Primer pair for identifying chicken parvovirus and application thereof
  • Primer pair for identifying chicken parvovirus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Embodiment 1, primer design

[0056] A large number of sequence analyzes and comparisons were carried out to obtain several primers for identifying chicken parvovirus. Preliminary experiments were carried out on each primer to compare performances such as sensitivity and specificity, and finally a pair of primers for identifying chicken parvovirus was obtained.

[0057] The specific primer pair used to identify chicken parvovirus consists of the following two primers (5'→3'):

[0058] ChPV-F (SEQ ID NO: 1 of the Sequence Listing): GTAAATTCTGTGCCGATTGTG;

[0059] ChPV-R (SEQ ID NO: 2 of the Sequence Listing): GAAGTCTGGCTCGTCTGGTAA.

Embodiment 2

[0060] Embodiment 2, optimization of two-temperature formula PCR reaction conditions

[0061] 1. Extract the genomic DNA of chicken parvovirus.

[0062] 2. Take the genomic DNA obtained in step 1 as a template, and use the primer pair prepared in Example 1 to perform two-temperature PCR.

[0063] Two-temperature PCR reaction system (25.0 μL): 2×PCR Mix 12.5 μL, template 1 μL (3.86 ng), ChPV-F and ChPV-R 1 μL each, and finally use ddH 2 O to make up to 25.0 μL. In the two-temperature PCR reaction system, the concentrations of ChPV-F and ChPV-R were both 10 pmol / μL.

[0064] The reaction program of two-temperature PCR: pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 15 seconds, annealing for 30 seconds, a total of 30 cycles, and extension at 72°C for 10 minutes.

[0065] Set the annealing temperature as follows:

[0066] Annealing temperature I: 51.0°C;

[0067] Annealing temperature II: 51.9°C;

[0068] Annealing temperature III: 53.5°C;

[0069] Anneali...

Embodiment 3

[0078] Embodiment 3, specificity

[0079] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: chicken parvovirus (ChPV), Marek virus (MDV), and infectious laryngotracheitis virus (ILTV).

[0080] 2. Extract the total RNA of the sample to be tested and reverse transcribe it into cDNA. The samples to be tested are: Newcastle Disease Virus (NDV), H9 Subtype Avian Influenza Virus (AIV H9), and Infectious Bronchitis Virus (IBV).

[0081] 3. Using the genomic DNA samples obtained in step 1 and the cDNA samples obtained in step 2 as templates, two-temperature PCR was performed using the primer combination prepared in Example 1.

[0082] Two-temperature PCR reaction system (25.0 μL): 2×PCRMix 12.5 μL, template 1 μL (3.86 ng), ChPV-F and ChPV-R 1 μL each, and finally use ddH 2 O to make up to 25.0 μL. In the two-temperature PCR reaction system, the concentrations of ChPV-F and ChPV-R were both 10 pmol / μL. Set up a negative control using an equal vo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer pair for identifying chicken parvovirus and application thereof. The primer pair provided by the invention consists of primers ChPV-F and ChPV-R which are as shown by sequence tables 1 and 2 respectively. The invention also discloses application of the primer pair to the identification whether a to-be-detected virus is the chicken parvovirus or not and application to the identification whether a to-be-detected sample contains the chicken parvovirus or not. A two-temperature PCR (Polymerase Chain Reaction) established by the invention can be used for quickly detecting the chicken parvovirus, and is applicable to large-batch detection; not only can the cost be economized and the time be saved, but also the pollution can be reduced. The primer pair for identifying the chicken parvovirus and the application thereof have quite high practical value.

Description

technical field [0001] The invention relates to a pair of primers for identifying chicken parvovirus and its application. Background technique [0002] Chicken parvovirus (Chincken parvovirus, ChPV) is one of the important pathogens that cause intestinal diseases in chickens. It can cause acute or chronic intestinal diseases characterized by diarrhea, mental depression, thermoregulation disorders, growth retardation, and increased feed consumption. , short stature syndrome, malnutrition syndrome. Chicken parvovirus is ubiquitous in chicken flocks and mainly affects chicks, but the infection rate is higher in commercial broilers, followed by laying hens or breeders. Since 2010, the disease has broken out in North America, Poland, Hungary, Croatia, Brazil, South Korea and other countries, causing large economic losses to the chicken industry. Therefore, the establishment of a rapid detection method for ChPV is the technical guarantee for the effective prevention and control ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/701C12Q1/686
Inventor 谢芝勋奉彬邓显文张艳芳黄娇玲王盛范晴谢志勤黄莉谢丽基曾婷婷罗思思刘加波
Owner GUANGXI VETERINARY RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap