Unlock instant, AI-driven research and patent intelligence for your innovation.

Effect detection method of B-subgroup poultry pulmonary virus vaccine

A poultry lung virus and vaccine technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of inability to show the amount of virus, changes, etc., to achieve simple detection and ensure accuracy Effect

Inactive Publication Date: 2017-01-04
YEBIO BIOENG OF QINGDAO
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, ordinary RT-PCR is mainly used for detection, but although the ordinary RT-PCR method can qualitatively detect the presence or absence of avian pneumovirus nucleic acid, it cannot show changes in the amount of virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Effect detection method of B-subgroup poultry pulmonary virus vaccine
  • Effect detection method of B-subgroup poultry pulmonary virus vaccine
  • Effect detection method of B-subgroup poultry pulmonary virus vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] The design of embodiment 1 primer

[0023] 1. Design of G protein primers

[0024] According to the sequence of A, B and C subgroups of avian pneumovirus (APV) in GenBank and a B subtype virus gene sequence isolated by our laboratory, the present invention designs several pairs of specificity against B subtype after performing homology analysis. Primers, the sequence information of the primers are as follows:

[0025] G1-S: CCGGGACAAGTATCTCTATGG

[0026] G1-AS:TGTTGACTGTCCTGGATGTAAG

[0027] G2-S:GGGACAAGTATCCAGATGGGG

[0028] G2-AS:GCATAACTGCGATCATGCATATC

[0029] G3-S:GGCGGAAAATGGATCCTTACATC

[0030] G3-AS: GGAGTTCCTCTGGGCAGTGGT

[0031] And designed two pairs of specific primers for the internal reference gene β-actin, and established a detection method for rapid detection of APV B subgroup viral load in different tissues.

[0032] Actin1-s: ATGTGCAAGGCCGGTTTCGC

[0033] Actin1-as: GTGGTGCCAGATCTTCTCCA

[0034] Actin2-s: TATTGCTGCGCTCGTTGTTGA

[0035] Actin...

Embodiment 2

[0045] Embodiment 2: the effect detection of primer set

[0046] IBV, IBDV, NDV, AIVH9, APV disease materials were detected by fluorescent quantitative RT-PCR.

[0047] 1. Primer Specificity Test

[0048] 1.1 Materials and methods

[0049] 1.1.1 Disease materials IBV, IBDV, NDV, AIVH9, APV disease materials are provided by Qingdao Ebang Bioengineering.

[0050] 1.1.2 Instruments and Reagents ABI 7500 Fluorescent Quantitative PCR Instrument, Beijing Tianenze Animal Column RNA Extraction Kit, Bao Biology PrimeScript TM RT-PCR Kit II, primers were synthesized by Shanghai Bioengineering Co., Ltd.

[0051] 1.1.3 Extraction of RNA Weigh 0.1-0.2 g of tissues from different disease materials and put them into the centrifuge tubes of MagNA Lyser GreenBeads, add 10 times the volume of normal saline, and put them on ice. Put the centrifuge tube into a medium-throughput tissue grinder, mash at 6000r / min for 45 seconds, quickly put it in an ice box to cool for 10 minutes, and repeat ...

Embodiment 3

[0065] Embodiment 3: the effect check of B subgroup poultry pneumovirus vaccine

[0066] 1. Materials and methods

[0067] 1.1 Strains Avian Pneumovirus Subgroup B SHS / B strain was isolated by Qingdao Yibang Bioengineering Co., Ltd.

[0068] 1.2SPF chickens were purchased from Beijing Meria Weitong Experimental Animal Technology Co., Ltd., and were reared in a negative pressure isolator in Qingdao Yibang animal room after purchase.

[0069] 1.3 Instruments and reagents ABI 7500 fluorescent quantitative PCR instrument, Beijing Tianenze animal column RNA extraction kit, Baobio PrimeScript TM RT-PCR Kit II, primers were synthesized by Shanghai Bioengineering Co., Ltd.

[0070] 1.4 Immunization and challenge Avian pneumovirus B subgroup SHS / B strain was prepared as a vaccine to immunize 21-day-old SPF chickens, and 21 days later, the SHS / B strain was challenged with nasal drops and eye drops. Five days after the challenge, the lungs were isolated.

[0071] 1.5 Extraction of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an effect detection method of a B-subgroup poultry pulmonary virus vaccine. The sequences of utilized primer groups are respectively SEQ ID NO:1 and SEQ ID NO:2. The invention provides a set of rapid diagnosis system capable of sensitively, specially, rapidly, stably, simply and conveniently detecting B-subgroup poultry pulmonary viruses based on a molecular method. By utilizing reference genes, the sample loading quantity and the experimental errors in a sample loading process are corrected, and the accuracy of an experimental result is guaranteed. According to the effect detection method, the level of the virus content can be effectively distinguished, so that the valence of the poultry pulmonary virus vaccine can be detected.

Description

technical field [0001] The invention belongs to the field of virus detection, and in particular relates to a method for detecting the efficacy of subgroup B avian pneumovirus vaccine. Background technique [0002] Avian pneumovirus (APV), also known as turkey rhinotracheitis virus (TRTV), is a single-stranded negative-sense RNA virus. Diseases caused by pneumoviruses were first identified in turkeys, causing respiratory disease in turkeys and resulting in decreased egg production. The APV genome contains eight major structural protein genes, N-P-M-F-M2-SH-G-L. According to its G protein difference and serological analysis, APV is divided into A subtype (UK) and B subtype (Continental Europe). The A subtype and B subtype are similar, but the G protein has only a 38% similarity rate. The subtype is widely prevalent in Europe. The main epidemic in my country is subtype B avian pneumovirus. At present, ordinary RT-PCR is mainly used for detection, but although ordinary RT-PC...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/701C12Q1/6851C12Q2531/113C12Q2563/107C12Q2545/101
Inventor 郭伟伟程增青徐保娟王丽萍朱艳梅宫晓李陆梅宋新宇张恒胡潇
Owner YEBIO BIOENG OF QINGDAO