Effect detection method of B-subgroup poultry pulmonary virus vaccine
A poultry lung virus and vaccine technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of inability to show the amount of virus, changes, etc., to achieve simple detection and ensure accuracy Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] The design of embodiment 1 primer
[0023] 1. Design of G protein primers
[0024] According to the sequence of A, B and C subgroups of avian pneumovirus (APV) in GenBank and a B subtype virus gene sequence isolated by our laboratory, the present invention designs several pairs of specificity against B subtype after performing homology analysis. Primers, the sequence information of the primers are as follows:
[0025] G1-S: CCGGGACAAGTATCTCTATGG
[0026] G1-AS:TGTTGACTGTCCTGGATGTAAG
[0027] G2-S:GGGACAAGTATCCAGATGGGG
[0028] G2-AS:GCATAACTGCGATCATGCATATC
[0029] G3-S:GGCGGAAAATGGATCCTTACATC
[0030] G3-AS: GGAGTTCCTCTGGGCAGTGGT
[0031] And designed two pairs of specific primers for the internal reference gene β-actin, and established a detection method for rapid detection of APV B subgroup viral load in different tissues.
[0032] Actin1-s: ATGTGCAAGGCCGGTTTCGC
[0033] Actin1-as: GTGGTGCCAGATCTTCTCCA
[0034] Actin2-s: TATTGCTGCGCTCGTTGTTGA
[0035] Actin...
Embodiment 2
[0045] Embodiment 2: the effect detection of primer set
[0046] IBV, IBDV, NDV, AIVH9, APV disease materials were detected by fluorescent quantitative RT-PCR.
[0047] 1. Primer Specificity Test
[0048] 1.1 Materials and methods
[0049] 1.1.1 Disease materials IBV, IBDV, NDV, AIVH9, APV disease materials are provided by Qingdao Ebang Bioengineering.
[0050] 1.1.2 Instruments and Reagents ABI 7500 Fluorescent Quantitative PCR Instrument, Beijing Tianenze Animal Column RNA Extraction Kit, Bao Biology PrimeScript TM RT-PCR Kit II, primers were synthesized by Shanghai Bioengineering Co., Ltd.
[0051] 1.1.3 Extraction of RNA Weigh 0.1-0.2 g of tissues from different disease materials and put them into the centrifuge tubes of MagNA Lyser GreenBeads, add 10 times the volume of normal saline, and put them on ice. Put the centrifuge tube into a medium-throughput tissue grinder, mash at 6000r / min for 45 seconds, quickly put it in an ice box to cool for 10 minutes, and repeat ...
Embodiment 3
[0065] Embodiment 3: the effect check of B subgroup poultry pneumovirus vaccine
[0066] 1. Materials and methods
[0067] 1.1 Strains Avian Pneumovirus Subgroup B SHS / B strain was isolated by Qingdao Yibang Bioengineering Co., Ltd.
[0068] 1.2SPF chickens were purchased from Beijing Meria Weitong Experimental Animal Technology Co., Ltd., and were reared in a negative pressure isolator in Qingdao Yibang animal room after purchase.
[0069] 1.3 Instruments and reagents ABI 7500 fluorescent quantitative PCR instrument, Beijing Tianenze animal column RNA extraction kit, Baobio PrimeScript TM RT-PCR Kit II, primers were synthesized by Shanghai Bioengineering Co., Ltd.
[0070] 1.4 Immunization and challenge Avian pneumovirus B subgroup SHS / B strain was prepared as a vaccine to immunize 21-day-old SPF chickens, and 21 days later, the SHS / B strain was challenged with nasal drops and eye drops. Five days after the challenge, the lungs were isolated.
[0071] 1.5 Extraction of ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


