Unlock instant, AI-driven research and patent intelligence for your innovation.

Antimicrobial peptide gene-loaded drug delivery system and construction and application thereof

A delivery system, antimicrobial peptide technology, applied in antibacterial drugs, drug combinations, biochemical equipment and methods, etc.

Active Publication Date: 2017-01-18
ZHEJIANG UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In vitro studies have found that bovine bone marrow antimicrobial peptide-28 (BMAP28) has a killing effect on a variety of dairy cow mastitis pathogens, suggesting that the BMAP28 gene can be used as a candidate gene for the development of gene therapy drugs for cow mastitis. However, there is no report on the use of BMAP28 for gene therapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antimicrobial peptide gene-loaded drug delivery system and construction and application thereof
  • Antimicrobial peptide gene-loaded drug delivery system and construction and application thereof
  • Antimicrobial peptide gene-loaded drug delivery system and construction and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of Drug Delivery System Carrying Antimicrobial Peptide Gene

[0031] 1. Construction of pEGFP-C3-SP plasmid

[0032] Primers were designed to construct a plasmid carrying the BMAP28 signal peptide (SP) sequence, and the signal peptide sequence was inserted after the start codon of the EGFP coding gene of the pEGFP-C3 plasmid. The upstream primer is: 5'-GGCGCTGGCCGAGGGCAGCGCTAGTCCCAGCAGCAGTAGCCAAAGGGCGAGGAGCTGTTCACCAC-3', and the downstream primer is: 5'-GAGACCCAGAGGGCCAGCCTCT CCCTGGGACGGTGGTCACTGGGTGGCGACCGGTAGCGCTAGCGGATCTC-3'. Primers were synthesized by Shanghai Sangong.

[0033] Using the pEGFP-C3 plasmid as a template, PCR amplification was performed with PrimeSTAR HS DNA polymerase. The PCR reaction conditions were: 94°C for 30s, 62°C for 30s, 72°C for 5min, 35 cycles. The amplified products were blunt-ended ligated with Blunting Kination Ligation Kit (operated according to the kit instructions). The ligation product was transformed into...

Embodiment 2

[0040] Example 2 Verification Test of Drug Delivery System Carrying Antimicrobial Peptide Gene

[0041] 1. Scanning electron microscope observation of chitosan-plasmid DNA complex

[0042] The chitosan / plasmid DNA complex was evenly spread on the sample stage, dried naturally, fixed with conductive glue and sprayed with gold, observed its morphological characteristics under a scanning electron microscope, and selected a representative field of view to take pictures. Scanning electron microscopy showed that CS / DNA75, CS / DNA 125 and CS / DNA 175 could all form spherical structures. Among them, CS / DNA75 formed more rod-shaped particles and less spherical particles; CS / DNA125 formed more spherical particles and fewer rod-shaped particles than CS / DNA75; Mostly in the range of 100-300nm (such as figure 2 shown).

[0043] 2. Determination of Encapsulation Efficiency of Plasmid DNA in Chitosan

[0044] Take 200 μL of the chitosan / plasmid DNA complex, and centrifuge at 10,000 g for ...

Embodiment 3

[0065] Example 3 Drug Delivery System Therapeutic Tests Carrying Antimicrobial Peptide Genes

[0066] This experiment was carried out on a dairy farm in the suburbs of Hangzhou. Through clinical observation, California mastitis test (CMT) and milk somatic cell count (SCC) (Fossmatic TM Minor) selected cows with a single udder area, and selected 9 udder areas with typical symptoms of clinical mastitis (redness and swelling in the udder area, milk clots) and 12 udder areas with subclinical mastitis (mammary glands with normal appearance and milk clots). No obvious visual changes, SCC>1.2 million / mL milk). Milk samples were collected aseptically, bacteria were isolated and cultured with blood plates, and routine morphological and biochemical identifications were performed on the isolated bacteria.

[0067] After milking and sterilizing the affected milk areas, each milk area was perfused with 50 mL of normal saline containing CS / DNA175 (containing 200 μg of plasmid DNA), and r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention aims to provide a drug delivery system with bovine antimicrobial peptide BMAP28 as therapeutic gene, a gene expression vector, a drug delivery vector and a preparation method and application thereof. The molecular cloning technique containing PCR technology, point mutation technology and enzyme digestion and connection, etc. is utilized, and a BMAP28 gene-carrying secretion-type eukaryotic expression plasmid is constructed. Naked plasmid DNA is encapsulated with chitosan nanoparticles to prepare the antimicrobial peptide gene-loaded drug delivery system. The drug delivery system of the invention can effectively mediate a gene drug to be expressed in eukaryotic cell and secreted to ectoenzyme. The system has good curative effects on cow mastitis.

Description

technical field [0001] The invention relates to the field of genetic engineering and pharmaceuticals, in particular to the construction of an antimicrobial peptide gene fusion expression plasmid and the preparation of a gene delivery system. Background technique [0002] Cow mastitis (mastitis) is a mammary gland disease that seriously harms mature dairy cows and can be caused by a variety of pathogenic microorganisms. For a long time, antibiotics have been widely used as conventional drugs for the treatment of mastitis in dairy cows, resulting in the emergence of drug-resistant strains, and the traditional antibiotics have gradually lost their therapeutic effect. The development of new antibacterial drugs has become an urgent clinical problem that needs to be solved. [0003] Antimicrobial peptides are a class of small molecule polypeptides with broad-spectrum antimicrobial effects. Unlike traditional antibiotics that exert antibacterial effects by interfering with bacteri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K9/51A61K47/36A61K38/17A61P15/14A61P31/04C12N15/85
CPCA61K9/5161A61K38/1709C07K14/47C07K2319/02C07K2319/60C12N15/85C12N2800/107
Inventor 谭勋樊国娟章乔艳
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More