Antimicrobial peptide gene-loaded drug delivery system and construction and application thereof
A delivery system, antimicrobial peptide technology, applied in antibacterial drugs, drug combinations, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Construction of Drug Delivery System Carrying Antimicrobial Peptide Gene
[0031] 1. Construction of pEGFP-C3-SP plasmid
[0032] Primers were designed to construct a plasmid carrying the BMAP28 signal peptide (SP) sequence, and the signal peptide sequence was inserted after the start codon of the EGFP coding gene of the pEGFP-C3 plasmid. The upstream primer is: 5'-GGCGCTGGCCGAGGGCAGCGCTAGTCCCAGCAGCAGTAGCCAAAGGGCGAGGAGCTGTTCACCAC-3', and the downstream primer is: 5'-GAGACCCAGAGGGCCAGCCTCT CCCTGGGACGGTGGTCACTGGGTGGCGACCGGTAGCGCTAGCGGATCTC-3'. Primers were synthesized by Shanghai Sangong.
[0033] Using the pEGFP-C3 plasmid as a template, PCR amplification was performed with PrimeSTAR HS DNA polymerase. The PCR reaction conditions were: 94°C for 30s, 62°C for 30s, 72°C for 5min, 35 cycles. The amplified products were blunt-ended ligated with Blunting Kination Ligation Kit (operated according to the kit instructions). The ligation product was transformed into...
Embodiment 2
[0040] Example 2 Verification Test of Drug Delivery System Carrying Antimicrobial Peptide Gene
[0041] 1. Scanning electron microscope observation of chitosan-plasmid DNA complex
[0042] The chitosan / plasmid DNA complex was evenly spread on the sample stage, dried naturally, fixed with conductive glue and sprayed with gold, observed its morphological characteristics under a scanning electron microscope, and selected a representative field of view to take pictures. Scanning electron microscopy showed that CS / DNA75, CS / DNA 125 and CS / DNA 175 could all form spherical structures. Among them, CS / DNA75 formed more rod-shaped particles and less spherical particles; CS / DNA125 formed more spherical particles and fewer rod-shaped particles than CS / DNA75; Mostly in the range of 100-300nm (such as figure 2 shown).
[0043] 2. Determination of Encapsulation Efficiency of Plasmid DNA in Chitosan
[0044] Take 200 μL of the chitosan / plasmid DNA complex, and centrifuge at 10,000 g for ...
Embodiment 3
[0065] Example 3 Drug Delivery System Therapeutic Tests Carrying Antimicrobial Peptide Genes
[0066] This experiment was carried out on a dairy farm in the suburbs of Hangzhou. Through clinical observation, California mastitis test (CMT) and milk somatic cell count (SCC) (Fossmatic TM Minor) selected cows with a single udder area, and selected 9 udder areas with typical symptoms of clinical mastitis (redness and swelling in the udder area, milk clots) and 12 udder areas with subclinical mastitis (mammary glands with normal appearance and milk clots). No obvious visual changes, SCC>1.2 million / mL milk). Milk samples were collected aseptically, bacteria were isolated and cultured with blood plates, and routine morphological and biochemical identifications were performed on the isolated bacteria.
[0067] After milking and sterilizing the affected milk areas, each milk area was perfused with 50 mL of normal saline containing CS / DNA175 (containing 200 μg of plasmid DNA), and r...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com