A kind of genetically engineered bacteria producing gentamicin b and its construction method
A gentamicin and construction method technology, applied in the fields of biotechnology and genetic engineering, can solve problems such as difficulties, high yield of gentamicin B, high price of isopamicin, etc., and achieve high yield and impurity generation. Fewer, genetically stable effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1: Construction of kanJ and kanK expression plasmids
[0037] Primer 1: 5' TTT GGATCC AGCGATGGCCCTTGCCGCTCC 3'
[0038] Primer 2: 5'GCG AAGCTT CATCGGCCGAAATCACACCAG 3'
[0039] Using primers Primer 1 and Primer 2, the kanJ and kanK gene fragments were cloned and amplified by PCR using the total DNA of Streptomyces kanagi as a template, and the fragments were connected to the pMD-18T vector for sequencing verification. It was found that KanJ had three amino acid mutations: T20P, V257L, and T277S ; KanK has two amino acid mutations: A49G, F245S. Verify that the correct recombination vector was cut with BamHI and HindIII and the promoter-containing P ermE *The pSPU241 was connected, transformed into Escherichia coli Top10 competent, and the positive clone was screened, named pJK241. Plasmid pJK241 was digested by BglⅡ, and P ermE *+kanJ and kanK fragments were ligated into pEAP1 (transformed from pSET152, ampicillin resistance was used to replace apramycin ...
Embodiment 2
[0040] Example 2: Conjugative transfer of site-specific integrated expression plasmids
[0041]The expression plasmid pKANJK1 was transformed into E.coli ET12567 (pUZ8002), and the three antibacterial strains of ampicillin, chloramphenicol and kanamycin were screened to obtain the donor bacteria E.coliET12567 ( pUZ8002, pKANJK1).
[0042] After primary and secondary culture and washing, the donor bacteria were mixed with M.purpurea△K△P monospore suspension that had been heat-activated at 50°C and pre-cultured at 37°C, spread evenly on the MS plate, and cultured at 28°C for 20~ After 24 hours, it was covered with erythromycin (20 μg / ml) and PPA (50 μg / ml) aqueous solution, and cultured at 28° C. (see the experimental method section for specific methods). After 7 days, positive clones grew out on the plate where E.coli ET12567 (pUZ8002, pKANJK1) was co-cultured with M.purpurea△K△P.
Embodiment 3
[0043] Embodiment 3: the acquisition of kanJ and kanK expression bacterial strain
[0044] The transformants were picked and cultured on a slant medium containing erythromycin (100 μg / mL) at 37°C for 7 days, excavated and inoculated for liquid culture, the total DNA was extracted as a template, and amplified by PCR with primers kanJK-P1 and kanJK-P2 Agarose gel electrophoresis verification, such as figure 1 As shown, a specific band with a size of about 2 kb was amplified, proving that kanJ and kanK had been transferred into Micromonospora rubrum. In order to further verify that the PCR amplification products were kanJ and kanK, the PCR products were sequenced after gel recovery, which was consistent with the kanJ and kanK sequences on the plasmid, proving that the kanJ and kanK expression strains were obtained and named KANJK1.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More