Efficient hydrogen-production functional gene vector pET32a-fdhF as well as construction and application thereof
A functional gene and gene carrier technology, applied in the field of genetic engineering, can solve the problems of less hydrogen production, increased hydrogen production performance, and difference in hydrogen production efficiency, and achieve the effect of improving Escherichia coli and improving hydrogen production efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] (1) Search for the homologous gene sequence of Bacillus cereus formate dehydrogenase on NCBI, then combine the pET32a plasmid sequence, and use DNAMAN software to design primers for the formate dehydrogenase gene with the vector homologous sequence. The designed primers were handed over to Sangon Bioengineering (Shanghai) Co., Ltd. for primer synthesis.
[0025] The designed primers are:
[0026] Forward-Primer: AACTTTAAGAAGGAGATATACATatggcagaacagacagtccgtgt
[0027] Reverse-Primer:
[0028] CAGCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGGTCCACAAGTGATACGTATTGT
[0029] (2) According to the designed primers, the fdhF gene fragment was amplified by PCR technique. PCR condition settings: denaturation at 95°C for 30s, annealing at 58°C for 30s, extension at 72°C for 3 minutes, 30 cycles; 50uL system: 25uL 2*HiFi-PCR Master, 22uLddH2O, 1uLDAN template, 2uL upstream primer (10umol / L), 2uL downstream primer (10umol / L). (Ready-to-use PCR amplification kit, Shanghai Sangong)
[0030...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com