Cargo plasmid as well as construction and application method of cargo plasmid
A construction method and plasmid technology, applied in biochemical equipment and methods, using vectors to introduce foreign genetic material, vectors, etc., to save test time and operation links, save test and time, and reduce test costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] In the following examples, the enzymes used were purchased from NEB, Anabaena 7120 was purchased from the Institute of Hydrobiology, Chinese Academy of Sciences, the sequence information of GFP and kan came from the NCBI database, the primers were synthesized by Jinweizhi, and the three-parent transformation plasmid (pRL271 / pRL623 / pIncP) Presented by Professor Wolk.
[0043] refer to Figure 2a-2b Obtain universal plasmid and carrier plasmid through this process for the present invention, exemplary process is as follows:
[0044] Mix 300 ng of DNA of vector plasmid pRL271 with 0.5 μl of restriction endonuclease Xho I, perform enzyme digestion, bathe in water at 37° C. for 1 hour, and obtain linearized vector fragment L-pRL271 after recovery. Using Anabaena 7120 genomic DNA as a template, using pt-up-1 (SEQ ID No: 9) and pt-up-2 (SEQ ID No: 10) as primers to amplify the upstream fragment of homologous recombination double exchange (SEQ ID No :3); using pt-down-1 (SEQ I...
Embodiment 2
[0051] Using the total genomic DNA of Houttuynia cordata 7120 as a template, the upstream and downstream primers of fragment 1 and the upstream and downstream primers of fragment 2 were used for PCR reaction. Reaction program: pre-denaturation at 98°C for 5 minutes; deformation at 98°C for 10 s, annealing at 60°C for 15 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min. The primer sequences are as follows:
[0052] Fragment one upstream primer:
[0053] CAGGTTAGGAGAACGCCGTCGACATGGCTAGCTACCAAGTTAG (SEQ ID No: 21)
[0054] Fragment one downstream primer:
[0055] CTGGATTCTGAGGCATGGTACCAGCAAGGTACGGTTC (SEQ ID No: 22)
[0056] Fragment 2 upstream primer:
[0057] CTGGTACCATGCCTCAGAATCCAGAAAG (SEQ ID No: 23)
[0058] Fragment 2 downstream primer:
[0059] CCAATATTTTTAATGATTTCAAGTCTAGACTAGCGGATCAAGTCAAAG (SEQ ID No: 24)
[0060] The two obtained fragments were connected into one fragment by fusion PCR method (denature the above-mentioned fragment 1 and f...
Embodiment 3
[0063] Cultivate wild-type and FdnifK strains until grown to OD 730 ≈0.8, divide the algae solution into 40ml to 60ml glass tubes, fill the glass tubes with argon to remove the air, seal them with rubber stoppers, and place them under light for cultivation. Hydrogen was determined by gas chromatography. The accumulation of hydrogen gas as Figure 4 As shown, the FdnifK strain can significantly increase the H 2 output.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



