Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of TEL gene in regulation and control of agronomic characters of Zea mays

A technology of agronomic traits and genes, applied in the direction of application, genetic engineering, and the use of vectors to introduce foreign genetic materials, etc., to achieve the effect of increasing corn yield

Inactive Publication Date: 2017-06-20
ZHEJIANG UNIV
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the effect of overexpression of PLA2 and its homologous genes in maize, and the effect of using tissue-specific promoters to regulate the overexpression of PLA2 and its homologous genes in maize have not been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of TEL gene in regulation and control of agronomic characters of Zea mays
  • Application of TEL gene in regulation and control of agronomic characters of Zea mays

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1, the cloning of TE1 gene expression cassette in maize and the construction of transformation vector

[0038] According to the TE1 gene polynucleotide sequence in the gene bank, PCR primers were designed to amplify the TE1 gene from the maize (Zea mays) genome. Since the TE1 gene is relatively large, the full-length gene, including the promoter, protein coding region and terminator, was obtained by 2 PCR fragments. The first fragment, including the promoter and part of the protein coding region, was amplified using the following PCR primers: ZMte3-13F (5'AAGCTTAGTGCCAATCACTGCGTGAGA) and ZMte-22R (5'CCTCGGGCTCCTTGAACAGGAA). The second fragment, including part of the protein coding region and the terminator, was amplified using the following PCR primers: ZMte-32F (5'TCGCAGGGGACTTGAAGGATGTGA) and ZMte-42R (5'GGTACCTATTTAAGATCTCACTTCAAGCTCTATGA). These two fragments were respectively cloned into pMD19-T vector. Then, the first fragment was excised from pMD19-T...

Embodiment 2

[0040] Embodiment 2, the cloning of maize TE1 gene cDNA

[0041] Cloning of TE1 gene cDNA in maize (Zea mays): PCR primers ZmTE1-F (5'GAGGATCCAACAGAATTCATGGGTGGGTTC) and ZmTE1-R (5'GCGGTCTAGATTACTAGTCGTCGTAGCCAAGC) were designed and amplified by PCR using the total cDNA of commercial maize variety Zhengdan 958 as a template The cDNA fragment of TE1 is about 2 kb in size. The PCR reaction conditions are: 95°C for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 2 minutes, repeating 33 cycles; 72°C for 10 minutes. The obtained PCR product of approximately 2 kb was cloned into the T-vector pMD19. Then, ZmTE1 was obtained by double digestion with BamHI and XbaI, and DNA sequence determination showed that its nucleotide sequence was correct (SEQ ID NO: 2). Afterwards, the cDNA obtained by enzyme digestion and the synthetic terminator ter1 (nucleotide sequence is SEQ ID NO: 8) are connected by XbaI to obtain a nucleotide sequence with a structure of ZmTE1-ter1, which ...

Embodiment 3

[0042] Embodiment 3, the cloning of tissue-specific promoter

[0043] Obtaining the ZmGA20ox1 promoter (pZmGA20ox1) of maize (Zea mays) gibberellin synthase gene: Design PCR primers pZmGA20ox1-F (5'TAAGCTTCTGCCATGACGTGATTGTCCCTGGC) and pZmGA20ox 1-R (5'GGGATCCAGGAGGGAGGAAGCAGAGGAGGAG) to the genome of commercial maize variety Zhengdan 958 As a template, pZmGA20ox1 was obtained by PCR amplification. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 2 minutes, repeating 30 cycles; and then 72°C for 10 minutes. The obtained PCR product of approximately 2 kb was cloned into the T-vector pMD19. Then, the corresponding promoter pZmGA20ox1 was obtained by double digestion with HindIII and BamHI, and DNA sequence determination showed that the nucleotide sequence of the promoter was correct (SEQ ID NO: 6).

[0044] Cloning of maize (Zea mays) auxin import carrier1 (AUX1) gene promoter (pAUX1): artificially synthesized AUX1 gene p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a TEL gene in regulation and control of agronomic characters of Zea mays. The TEL gene has a nucleotide sequence shown in SEQ ID NO: 2, and an encoding protein of the TEL gene has an amino acid sequence shown in SEQ ID NO: 3. According to the application, the function that characters such as plant height, growth potential and seed yield of the Zea mays can be regulated and controlled through regulating and controlling the expression of a TE1 gene and homologous genes thereof in the Zea mays is discovered for the first time; the condition that the characters such as the plant height, the growth potential and the seed yield of the Zea mays can be regulated and controlled through increasing the TE1 gene and the homologous genes thereof by using a regulating and controlling element is discovered for the first time, and then, the yield of the Zea mays is increased; and the condition that the characters such as the plant height, the growth potential and the seed yield of the Zea mays can be improved through regulating and controlling the overexpression of the TE1 gene and the homologous genes thereof in the Zea mays by using a tissue-specific promoter is discovered for the first time, and then, the yield of the Zea mays is increased.

Description

[0001] (1) Technical field [0002] The invention relates to a gene capable of regulating the growth of corn and its application in the improvement of transgenic corn. This gene can be used to express in maize to regulate the yield-related traits of maize, such as plant height, biomass, growth vigor, grain weight and grain filling, so as to improve maize yield. [0003] (2) Background technology [0004] Through genetic modification, the traits of crops can be improved, such as obtaining insect resistance, herbicide resistance, increasing yield, enhancing drought resistance, and disease resistance. In crop production, improving the traits of crops is still an important content in the cultivation of new crop varieties and has great value. The improvement of crops through genetic engineering is an important means of crop improvement at present. [0005] In addition to insect-resistant and herbicide-resistant transgenic crops, high yield is also an important content of transgeni...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00
CPCC12N15/8261C12N15/823C12N2830/008C12N2830/36
Inventor 张先文王东芳刘苗苗沈志成
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com