Primers capable of simultaneously detecting various diarrhea pathogenic bacteria and application of primers

A technology of pathogenic bacteria and pathogenic bacteria, applied in the field of kits for simultaneous detection of multiple diarrhea pathogenic bacteria, can solve problems such as cumbersome operation, missed detection, and large human influence

Inactive Publication Date: 2017-06-20
HANGZHOU DIAN BIOTECH CO LTD +1
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a primer for simultaneously amplifying a variety of diarrheal pathogenic bacteria, to solve the problems in the prior art that the operation is cumbersome, time-consuming, human-influenced, and likely to cause missed detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers capable of simultaneously detecting various diarrhea pathogenic bacteria and application of primers
  • Primers capable of simultaneously detecting various diarrhea pathogenic bacteria and application of primers
  • Primers capable of simultaneously detecting various diarrhea pathogenic bacteria and application of primers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0098] The primers and probes for detecting 13 kinds of diarrhea pathogens were synthesized by Yingwei Jieji (Shanghai) Trading Co., Ltd. In practical application, the primer pairs and probes of three kinds of bacteria are divided into one group, as follows:

[0099] The first set of primer pairs for amplifying the nuc gene of Staphylococcus aureus, the ipaH gene of Shigella, and the tlh gene of Vibrio Parahemolyticus includes the following three pairs of primers and probes:

[0100] Primer pairs and probes for detection of S. aureus nuc gene:

[0101] F1 (SEQ ID NO.: 1): ATCCTAAAAAAGGTGTAGAG,

[0102] R1 (SEQ ID NO.: 2): TATCAGTTCTTTGACCTTTG,

[0103] P1 (SEQ ID NO.: 3): FAM-ATATGGTCCTGAAGCAAGTGCA-MGB;

[0104] Primers and probes for detection of Shigella ipaH gene:

[0105] F2 (SEQ ID NO.: 4): ATAAAGTCAGAACTCTCC,

[0106] R2 (SEQ ID NO.: 5): AACGCATTTCCTTCACGG,

[0107] P2 (SEQ ID NO.: 6): VIC-ATGAGATAGAAGTCTACCTGGCCTTCC-TAMRA;

[0108] Primers and probes for detecting...

Embodiment 2

[0164] Embodiment 2: the preparation method of kit.

[0165] (1) PCR reaction solution: 10*PCR reaction buffer, Q-solution, DNA polymerase, Mg2+ and dNTPs, stored at -20°C;

[0166] (2) Primer and probe mixture: The nucleotide sequences shown in SEQ ID NO.: 1-39 were synthesized by Yingwei Jieji (Shanghai) Trading Co., Ltd., and then according to grouping, three primer pairs and probes were synthesized. The needles were mixed in one tube, dissolved in double distilled water, the final concentration of each primer was 1 μmol / L, and stored at -20°C;

[0167] (3) Positive control: containing 13 kinds of diarrhea pathogenic bacterial genomic DNA respectively, wherein, the concentration of each bacterial genomic DNA containing a drug-resistant gene is 10 ng / μL, and stored at -20°C;

[0168] (4) Negative control: the concentration of Escherichia coli genomic DNA was 100 ng / μL, and stored at -20°C.

Embodiment 3

[0169] Embodiment 3: detection method.

[0170] Instrument: Roche 480 fluorescent quantitative PCR detector, BECKMAN 22R desktop micro-refrigerated centrifuge, Eppendorf 5810R desktop refrigerated centrifuge, Taicang Hualida Laboratory Equipment Company WH-866 vortex oscillator.

[0171] (1) Fecal sample pretreatment: 1. Sample pretreatment: Weigh 1g of fecal sample and suspend it in 9ml sterile PBS, shake vigorously for 15min, centrifuge at 200r / min for 3 times, each time for 5min, collect the supernatant; then 5000r / min Centrifuge for 3 minutes, collect the bacterial pellet, suspend the pellet with 1ml PBS, and repeat the centrifugation until the supernatant is basically clear; finally, suspend the collected pellet with 1ml PBS, and store it in a 2ml Eppendorf tube at -20°C for later use.

[0172] (2) Preparation of bacterial genomic DNA template: referring to published literature, different types of bacterial specimens were used, and corresponding commercial genomic DNA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers capable of simultaneously detecting various diarrhea pathogenic bacteria and an application of the primers, and belongs to the field of nucleic acid detection of pathogenic bacteria. The invention discloses primers and probes as shown in SEQ ID NO: 1-39; and the primers and the probes can be used for rapidly and accurately detecting staphylococcus aureus, shigella, vibrio parahaemolyticus, yersinia enterocolitica, clostridium difficile, plesiomonas sp, listeria monocytogenes, escherichia coli O157:H7, aeromonas, salmonella, clostridium perfringens, bacillus cereus and campylobacter jejuni; therefore, great convenience is brought to clinical microorganism detection.

Description

technical field [0001] The invention belongs to the field of detection of pathogenic microorganisms, and in particular relates to a kit for simultaneously detecting multiple diarrhea pathogenic bacteria and its application. Background technique [0002] Infectious diarrhea is an important global public health problem today. Diarrhea kills about 5 million children under 5 years old in Asia, Africa, and Latin America every year, and the annual incidence is about 750 million to 1 billion. The pathogens of infectious diarrhea mainly include Salmonella, Shigella, Campylobacter jejuni, and pathogenic Escherichia coli. At present, the detection of diarrhea pathogens mainly includes conventional isolation and culture, biochemical identification, immunological methods, and molecular biological methods. Conventional isolation and culture operations are cumbersome, time-consuming, and human-influenced, which is likely to cause missed detection; immunological methods do not require com...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12Q1/14C12Q1/10C12N15/11
CPCC12Q1/686C12Q1/689C12Q2600/16C12Q2563/107C12Q2545/114C12Q2537/143Y02A50/30
Inventor任绪义虞闰六杨燚超
OwnerHANGZHOU DIAN BIOTECH CO LTD