A dna fragment with promoter function of bacillus subtilis and application thereof
A Bacillus subtilis and promoter technology is applied in the field of DNA fragments to achieve the effect of strong specific expression activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Culture of bacteria: Bacillus subtilis 168 was taken out from the -80°C glycerol tube and streaked on an LB solid plate at 37°C for 16-24h, and a single colony was picked and placed in 10mL of LB liquid with 1% final concentration of cornstarch culture medium, 37°C, 200rpm to OD 600 20-25 (spectrophotometer, Hitachi, Japan).
Embodiment 2
[0034] Extraction of bacterial total RNA, establishment of transcriptome library and RNA-Seq sequencing: collect 1 mL of the cell culture solution obtained in Example 1 and centrifuge rapidly at 8000g for 1 min to extract total bacterial RNA (see figure 1 ). For the specific extraction method, refer to the Bacterial Total RNA Extraction Kit from OmegaBio-tek Company. The samples used for RNA-Seq sequencing library preparation were qualified by the Agilent Technologies 2100 Bioanalyzer, and the mixed DNA molecules were treated with DNaseI (RNase Free), and Ribo-Zero (Gram-Positive Bacteria) kit (USA) was used to remove most of the total RNA. rRNA, purified mRNA. The mRNA was first broken into fragments of appropriate size, using the fragmented mRNA as a template, reverse transcriptase and random primers were added to synthesize double-stranded cDNA, and then the synthesized cDNA was purified with the kit QIAquick PCR Purification Kit (Qiagen). Fill in the cohesive ends of the...
Embodiment 3
[0036] Screening and cloning of promoter fragments: Analyze the transcript structure of Bacillus subtilis through RNA-Seq sequencing data and the genome-wide analysis of genes containing transcription start positions, and quantify by RPKM to screen a highly expressed gene and its nucleotide sequence As follows:
[0037]CGTTCTGTTACAGATGGAGGCGACAGCTTAATTTTTCTGCCTAATTCCCTCATCGACAAACGGCTGTCCTTCTTCAGCTCCTCAATGATATTCAGATCAATCTGGTCAAGTTTCATTTCAACATCCTTCTTTTTTGATTTTGTACACATTATCTCGGGTATTTTTGTAAATGACAAGTACAGTTCCCTAGAAAAGGCATGTAAAAATGAATGTTTTCCGAACATTTTTTGAAAGCTGTCATATGCCCCCCCGGATTGTTTATAGTATAAAATGAAAACGTGTCCACAAGGAGGGCGATTT。
[0038] Using the genomic DNA of the strain Bacillus subtilis (Bacillus subtilis 168) as a template, primers F-P ydzA (5'-CGGAATTCCGTTCTGTTACAGATGGAGG-3') and R-P ydzA (5'-GGACTAGTAAATCGCCCTCCTTGTGGAC-3') to amplify a 300bp DNA fragment, namely P ydzA Promoter fragment (see figure 2 ), consistent with the size of the target product. Introduced restriction site...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap