Method for preparing L-ascorbyl-2-glucoside
A technology of sucrose and AA-2G, applied in the field of biocatalyst preparation of L-ascorbic acid-2-glucoside and preparation of L-ascorbic acid-2-glucoside, can solve the problems of poor water solubility, unfavorable conversion, high price problem
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0096] Embodiment 1, the construction of sucrose phosphorylase clone strain pet28 a(+)-spase
[0097] The cryopreserved Bifidobacterium longum was revived and subcultured twice, and the bacterial liquid was used as a DNA template. A pair of primers were designed using the sucrose phosphorylase gene sequence of Bifidobacterium longum on NCBI as a template:
[0098] Forward primer (spase-bam-F): 5’ CGCGGATCCATGAAAAACAAAGTGCAGCTCATC 3’
[0099] Reverse primer (spase-hind-R): 5’ CCCAAGCTTGTCGATATCGGCAATCGG 3’
[0100] Then carry out PCR reaction, reaction conditions: 95°C pre-denaturation for 1min, then 30 cycles (95°C 10S, 49°C-64°C 12S, 72°C 22S), and 72°C extension for 5min.
[0101] In the site-directed mutagenesis experiment of sucrose phosphorylase, different mutation primers were designed and the above-mentioned PCR reaction was carried out.
[0102] After the PCR reaction is completed, after gel recovery, verification and purification, the product of the PCR reaction an...
Embodiment 2
[0104] Embodiment 2, the construction of sucrose phosphorylase clone strain pet28 a(+)-spase
[0105] The cryopreserved Bifidobacterium longum was revived and subcultured twice, and the bacterial liquid was used as a DNA template. A pair of primers were designed using the sucrose phosphorylase gene sequence of Bifidobacterium longum on NCBI as a template:
[0106] Forward primer (spase-bam-F): 5’ CGCGGATCCATGAAAAACAAAGTGCAGCTCATC 3’
[0107] Reverse primer (spase-hind-R): 5’ CCCAAGCTTGTCGATATCGGCAATCGG 3’
[0108] Then carry out PCR reaction, reaction conditions: pre-denaturation at 92°C for 2 minutes, then 40 cycles (92°C for 10S, 49°C to 64°C for 10S, 68°C for 25S), and extension at 68°C for 7 minutes.
[0109] In the site-directed mutagenesis experiment of sucrose phosphorylase, different mutation primers were designed and the above-mentioned PCR reaction was carried out.
[0110] After the PCR reaction is completed, after gel recovery, verification and purification, the...
Embodiment 3
[0112] Embodiment 3, the construction of sucrose phosphorylase clone strain pet28 a(+)-spase
[0113] The cryopreserved Bifidobacterium longum was revived and subcultured twice, and the bacterial liquid was used as a DNA template. A pair of primers were designed using the sucrose phosphorylase gene sequence of Bifidobacterium longum on NCBI as a template:
[0114] Forward primer (spase-bam-F): 5’ CGCGGATCCATGAAAAACAAAGTGCAGCTCATC 3’
[0115] Reverse primer (spase-hind-R): 5’ CCCAAGCTTGTCGATATCGGCAATCGG 3’
[0116] Then carry out PCR reaction, reaction conditions: 98°C pre-denaturation for 0.5min, then 20 cycles (98°C 15S, 49°C-64°C 15S, 75°C 18S), 75°C extension for 3min.
[0117] In the site-directed mutagenesis experiment of sucrose phosphorylase, different mutation primers were designed and the above-mentioned PCR reaction was carried out.
[0118] After the PCR reaction is completed, after gel recovery, verification and purification, the product of the PCR reaction and th...
PUM
| Property | Measurement | Unit |
|---|---|---|
| wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 