Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer composition for detecting staphylococcus aureus, reagent kit and dual-signal-path detection method thereof

A technology of primer composition and dual signal channels, applied in the field of primer composition for detecting Staphylococcus aureus, can solve problems such as the interpretation of unfavorable results, and achieve the effect of expanding applications and places of use

Inactive Publication Date: 2017-08-18
SHANGHAI IGENETEC DIAGNOSTICS CO LTD
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In addition, the results of the current nucleic acid amplification reaction system are usually determined by means of a fluorescence analyzer (such as a fluorescent quantitative PCR instrument, etc.), which is not conducive to rapid result interpretation in outpatient and emergency departments, on-site, etc., and it is necessary to introduce a specificity, high sensitivity , easy-to-operate color change color indicator

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer composition for detecting staphylococcus aureus, reagent kit and dual-signal-path detection method thereof
  • Primer composition for detecting staphylococcus aureus, reagent kit and dual-signal-path detection method thereof
  • Primer composition for detecting staphylococcus aureus, reagent kit and dual-signal-path detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] This embodiment is a dual signal channel detection method for detecting Staphylococcus aureus, which is combined with a microfluidic chip.

[0064] (1) The structure of the microfluidic chip used in this embodiment;

[0065] Such as figure 1 As shown, the microfluidic chip used in the present invention is a disc-shaped microfluidic chip, which includes 4 reaction detection parts, each reaction detection part includes a sample hole 1, a liquid storage area 2, a reserved area 3, a reaction Hole 4, ball valve 5, waste liquid tank 6, exhaust hole 7, first arc channel 8 and second arc channel 9, wherein ball valve 5 is a capillary valve, its size is very critical, on the one hand, it is beneficial to complete liquid Secondary centrifugal distribution (50 ~ 300um), the second aspect prevents liquid evaporation and cross-contamination between different reaction wells; the first arc channel 8 and the second arc channel 9 are located on the film, the first arc channel 8 connec...

Embodiment 2

[0114] This embodiment is a dual signal channel detection method for detecting Listeria monocytogenes.

[0115] 1) nucleic acid extraction from the sample to be tested;

[0116] The total genomic nucleic acid of the actual sample (stool sample) of Listeria monocytogenes was extracted by the magnetic bead method, and the magnetic bead nucleic acid extraction steps:

[0117] a. Take 200 μl of the sample to be tested, add 20 μl of proteinase K solution and 400 μl of lysate in sequence, vortex for 10 seconds, and incubate at 56°C for 10 minutes.

[0118] b. Add 300 μl of isopropanol and 2 μL of magnetic beads, and invert the centrifuge tube 10 times to make the magnetic beads in the tube evenly distributed.

[0119] c. Let the centrifuge tube stand for 10 minutes, and turn the centrifuge tube up and down 5 times every two minutes to make the magnetic beads in the tube evenly distributed.

[0120] d. Place the centrifuge tube on a centrifuge, centrifuge at 10,000 g for 1 min, and...

Embodiment 3

[0145] This example is a dual-signal channel detection method for detecting transgenic soybean genes.

[0146] 1) MON87701 strain system preparation:

[0147] 20mM Tris-HCl (pH 8.8@25℃), 10mM KCl, 10mM (NH 4 ) 2 SO 4, 8mM MgS04, 0.1% Tween-20, 20×DNA intercalation dye (SYBR Green), color indicator (neutral red). F3 / B3=0.2uM; FIP / BIP=1.6uM; LF / LB=0.8uM. Bst enzyme 8U.

[0148] MON87701 strain system-specific primers include:

[0149] Outer primer 1: CACGCTTAGTGTGTGTGTGT (SEQ ID No: 9);

[0150] Outer primer 2: CGACCACGGAAAAAAAACAC (SEQ ID No: 10);

[0151] Inner primer 1:

[0152] CGATATCAAGCTTGATGGGGATCACAAACACTGATAGTTTAAACTGAAG (SEQ ID No: 11);

[0153] Internal primer 2: CGGGGGATCCACTAGTTCTTAGTGAATTCGAGCTCGGTAC (SEQ ID No: 12);

[0154] 2) Test sample preparation:

[0155] MON87701 negative control, positive control;

[0156] MON87701 plasmid dilution.

[0157] final concentration after dilution 1×10 6

1×10 5

1×10 4

5×10 3

1×10 3

5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a primer composition for detecting staphylococcus aureus, a reagent kit and a dual-signal-path detection method thereof. The method comprises the steps that nucleic acid extraction is performed on a sample to be detected; an isothermal amplification reaction is performed, wherein the isothermal amplification reaction is performed in a reaction system containing a color indicator, DNA embedded dye, DNA of the sample to be detected and amplification primers thereof; result interpretation is performed, wherein according to color changes of the indicator obtained after amplification is ended, direct naked eye interpretation is performed and / or a special instrument is combined for detecting a nucleic acid amplification curve for interpretation. In the reaction system, the macroscopic indicator is added, and the problem that an operator cannot recognize whether samples are added successfully or nor is avoided; according to the dual-signal-path detection method the DNA embedded dye is combined with the matched instrument for detecting the amplification curve, and the macroscopic observation result of the indicator is obtained, one signal path can be selected for result determination according to the requirement for application scenarios, and the method is easier, more convenient to implement, rapid, easy to implement and applicable to field operation in actual application.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a primer composition for detecting Staphylococcus aureus, a kit and a dual signal channel detection method thereof. Background technique [0002] According to the actual situation, any isothermal amplification technology mediated by Bst DNA polymerase (including cross-primer isothermal amplification CPA; loop-mediated isothermal nucleic acid amplification LAMP; intelligent isothermal nucleic acid amplification SMAP; multi- Self-assortment induced amplification IMSA and other techniques). [0003] Loop-mediated constant temperature amplification uses strand-displacing DNA polymerase and specific primers to ensure that the primers are successfully combined with the template under isothermal conditions and carry out strand-displacement amplification reactions. It can achieve continuous and rapid amplification under constant temperature conditions, and has high sensitivity, s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/14C12N15/11C12R1/445
CPCC12Q1/6806C12Q1/6844C12Q1/689C12Q2531/119C12Q2563/143C12Q2563/149
Inventor 方雪恩王欣珍王雄孔继烈
Owner SHANGHAI IGENETEC DIAGNOSTICS CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More