Primer composition for detecting staphylococcus aureus, reagent kit and dual-signal-path detection method thereof
A technology of primer composition and dual signal channels, applied in the field of primer composition for detecting Staphylococcus aureus, can solve problems such as the interpretation of unfavorable results, and achieve the effect of expanding applications and places of use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] This embodiment is a dual signal channel detection method for detecting Staphylococcus aureus, which is combined with a microfluidic chip.
[0064] (1) The structure of the microfluidic chip used in this embodiment;
[0065] Such as figure 1 As shown, the microfluidic chip used in the present invention is a disc-shaped microfluidic chip, which includes 4 reaction detection parts, each reaction detection part includes a sample hole 1, a liquid storage area 2, a reserved area 3, a reaction Hole 4, ball valve 5, waste liquid tank 6, exhaust hole 7, first arc channel 8 and second arc channel 9, wherein ball valve 5 is a capillary valve, its size is very critical, on the one hand, it is beneficial to complete liquid Secondary centrifugal distribution (50 ~ 300um), the second aspect prevents liquid evaporation and cross-contamination between different reaction wells; the first arc channel 8 and the second arc channel 9 are located on the film, the first arc channel 8 connec...
Embodiment 2
[0114] This embodiment is a dual signal channel detection method for detecting Listeria monocytogenes.
[0115] 1) nucleic acid extraction from the sample to be tested;
[0116] The total genomic nucleic acid of the actual sample (stool sample) of Listeria monocytogenes was extracted by the magnetic bead method, and the magnetic bead nucleic acid extraction steps:
[0117] a. Take 200 μl of the sample to be tested, add 20 μl of proteinase K solution and 400 μl of lysate in sequence, vortex for 10 seconds, and incubate at 56°C for 10 minutes.
[0118] b. Add 300 μl of isopropanol and 2 μL of magnetic beads, and invert the centrifuge tube 10 times to make the magnetic beads in the tube evenly distributed.
[0119] c. Let the centrifuge tube stand for 10 minutes, and turn the centrifuge tube up and down 5 times every two minutes to make the magnetic beads in the tube evenly distributed.
[0120] d. Place the centrifuge tube on a centrifuge, centrifuge at 10,000 g for 1 min, and...
Embodiment 3
[0145] This example is a dual-signal channel detection method for detecting transgenic soybean genes.
[0146] 1) MON87701 strain system preparation:
[0147] 20mM Tris-HCl (pH 8.8@25℃), 10mM KCl, 10mM (NH 4 ) 2 SO 4, 8mM MgS04, 0.1% Tween-20, 20×DNA intercalation dye (SYBR Green), color indicator (neutral red). F3 / B3=0.2uM; FIP / BIP=1.6uM; LF / LB=0.8uM. Bst enzyme 8U.
[0148] MON87701 strain system-specific primers include:
[0149] Outer primer 1: CACGCTTAGTGTGTGTGTGT (SEQ ID No: 9);
[0150] Outer primer 2: CGACCACGGAAAAAAAACAC (SEQ ID No: 10);
[0151] Inner primer 1:
[0152] CGATATCAAGCTTGATGGGGATCACAAACACTGATAGTTTAAACTGAAG (SEQ ID No: 11);
[0153] Internal primer 2: CGGGGGATCCACTAGTTCTTAGTGAATTCGAGCTCGGTAC (SEQ ID No: 12);
[0154] 2) Test sample preparation:
[0155] MON87701 negative control, positive control;
[0156] MON87701 plasmid dilution.
[0157] final concentration after dilution 1×10 6
1×10 5
1×10 4
5×10 3
1×10 3
5...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


