Genetic transformation method for sphingomonas

A technology of sphingomonas and genetic transformation, applied in the direction of microorganism-based methods, biochemical equipment and methods, using vectors to introduce foreign genetic material, etc. Problems such as duplication, to achieve the effect of clear thinking, easy operation and low conversion efficiency

Inactive Publication Date: 2017-09-15
KUNMING INST OF BOTANY - CHINESE ACAD OF SCI
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the replicons of commonly used plasmids cannot replicate in Sphingomonas, it is impossible to introduce plasmids or plasmids carrying foreign genes into Sphingomonas and make them replicate in vivo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic transformation method for sphingomonas
  • Genetic transformation method for sphingomonas
  • Genetic transformation method for sphingomonas

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] A method for electric shock transformation of Sphingomonas provided by the present invention comprises four steps of constructing necessary plasmids for transformation and preparing competent cells, electric shock transformation, and post-transformation effect verification; wherein, said construction transformation necessary The plasmid includes the following steps in turn: the extraction of the endogenous plasmid of Sphingomonas is realized by a common plasmid extraction kit, and the DNA fragment with the endogenous plasmid replicon is connected with the plasmid pHSG398, and the obtained A plasmid replicated in the bacterium; the preparation of competent cells comprises the steps of: activating Sphingomonas in LB medium, inoculating the activated Sphingomonas in TB medium, and culturing with shaking , cultivated to OD600nm=0.8; the preparation method of the TB medium is: fully mix 12g peptone, 24g yeast powder, 4g glycerin, 2.312g potassium dihydrogen phosphate, 16.416g...

Embodiment 2

[0099] Electroporation transformation of Sphingomonas:

[0100] 1. Construction of necessary plasmids for transformation of Sphingomonas KIB (preservation number: CGMCC No.12394):

[0101] Plasmid pHSG398 (see map figure 1 ): purchased from Takara Company;

[0102] Shuttle plasmids pHSG398‐RepB, ​​pHSG398‐RepE, pHSG398‐RepS are transformed on the basis of pHSG398 plasmid, and the preparation method is as follows:

[0103] 1. The extraction of the endogenous plasmid of Sphingomonas is realized by a commonly used plasmid extraction kit, and the obtained endogenous plasmid is digested with restriction endonucleases BamH Ⅰ, EcoR Ⅰ, Sal Ⅰ respectively, and the lengths obtained are respectively 6kb, 5kb, 3kb DNA fragments containing endogenous plasmid replicons.

[0104] 2. The plasmid pHSG398 with chloramphenicol resistance was digested with restriction endonucleases BamH Ⅰ, EcoR Ⅰ, Sal Ⅰ respectively, and ligated with the above-mentioned three different sizes of DNA fragments c...

Embodiment 3

[0148] In order to further determine the shortest effective fragment needed for Sphingomonas transformation, improve transformation efficiency, the present invention has carried out following test simultaneously, and draws a result:

[0149]1. Plasmids pHSG398-RepD-1, pHSG398-RepD-2, pHSG398-RepD-3, pHSG398-RepD-4 are transformed on the basis of pHSG398-RepS plasmid, and the preparation method is as follows:

[0150] Using the shuttle plasmid pHSG398‐RepS as a template, pHSGF 1240 TGGCACTGGCCGTCGTTTTACAAC and RepR 1728 CAAGCTTGCGCCTGTTCGCGTCCAGTCCT was the upstream and downstream primers, and after amplification, the plasmid pHSG398-RepD-1 was obtained by self-ligation. The PCR system and steps are as follows:

[0151]

[0152]

[0153] The total reaction volume is 20 μl, pre-denaturation at 98°C for 1 min, denaturation at 98°C for 10 s, annealing at 60°C for 5 s, extension at 72°C for 150 s, 35 cycles, and extension at 72°C for 5 min. After the gel recovery of the am...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetic transformation method for sphingomonas by electric shock. The method includes the steps: (1) providing sphingomonas KIB strains; (2) building carriers needed by transformation of the sphingomonas by electric shock; (3) preparing competent cells of the sphingomonas; (4) transforming the competent cells by electric shock; (5) culturing cells after transformation; (6) transforming verification for genetic modification effect. Indigenous plasmid replicons of the sphingomonas are connected with the carrier pHSG398 to obtain plasmids capable of being copied in the sphingomonas in the step (2). The genetic transformation method has the advantages that transformation efficiency and repeatability of the sphingomonas are remarkably improved, the method is simple and convenient to operate and an effective means for genetic manipulation and research of the sphingomonas, a convenient, rapid and efficient gene introduction method is provided and used for research of genetic engineering breeding, genetics and molecular biology of the sphingomonas, and the genetic transformation method can be used for research and industrial application of mechanisms such as degradation of aromatic compounds, extracellular production of cooling gel and intracellular production of carotenoid of the sphingomonas.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a sphingomonas and a method for genetically transforming the sphingomonas by electric shock. Background technique [0002] Sphingomonas is a rich new type of microbial resource, which is extremely widely distributed on the earth, and it exists in various water bodies, soils, atmospheres and extreme environments. Sphingomonas belongs to the class a‐Proteobacteria, Sphingomonales, and Sphingomonaceae. The strains of this genus are Gram-negative bacteria, without spores, moving with unilateral polar flagella, mostly yellow, obligate to aerobic and able to produce catalase. Sphingomonas itself has a strong metabolic ability, can degrade aromatic compounds, and has potential application value for environmental protection; some strains of this genus can synthesize valuable extracellular biopolymers, which have high At the same time, some strains of this genus can synthesize a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12N1/21C12N15/74C12R1/01
CPCC12N15/74C12N2800/101C12N2820/55C12N1/205C12R2001/01
Inventor刘萌萌黄俊潮叶景润赵启超
OwnerKUNMING INST OF BOTANY - CHINESE ACAD OF SCI