Genetic transformation method for sphingomonas
A technology of sphingomonas and genetic transformation, applied in the direction of microorganism-based methods, biochemical equipment and methods, using vectors to introduce foreign genetic material, etc. Problems such as duplication, to achieve the effect of clear thinking, easy operation and low conversion efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0070] A method for electric shock transformation of Sphingomonas provided by the present invention comprises four steps of constructing necessary plasmids for transformation and preparing competent cells, electric shock transformation, and post-transformation effect verification; wherein, said construction transformation necessary The plasmid includes the following steps in turn: the extraction of the endogenous plasmid of Sphingomonas is realized by a common plasmid extraction kit, and the DNA fragment with the endogenous plasmid replicon is connected with the plasmid pHSG398, and the obtained A plasmid replicated in the bacterium; the preparation of competent cells comprises the steps of: activating Sphingomonas in LB medium, inoculating the activated Sphingomonas in TB medium, and culturing with shaking , cultivated to OD600nm=0.8; the preparation method of the TB medium is: fully mix 12g peptone, 24g yeast powder, 4g glycerin, 2.312g potassium dihydrogen phosphate, 16.416g...
Embodiment 2
[0099] Electroporation transformation of Sphingomonas:
[0100] 1. Construction of necessary plasmids for transformation of Sphingomonas KIB (preservation number: CGMCC No.12394):
[0101] Plasmid pHSG398 (see map figure 1 ): purchased from Takara Company;
[0102] Shuttle plasmids pHSG398‐RepB, pHSG398‐RepE, pHSG398‐RepS are transformed on the basis of pHSG398 plasmid, and the preparation method is as follows:
[0103] 1. The extraction of the endogenous plasmid of Sphingomonas is realized by a commonly used plasmid extraction kit, and the obtained endogenous plasmid is digested with restriction endonucleases BamH Ⅰ, EcoR Ⅰ, Sal Ⅰ respectively, and the lengths obtained are respectively 6kb, 5kb, 3kb DNA fragments containing endogenous plasmid replicons.
[0104] 2. The plasmid pHSG398 with chloramphenicol resistance was digested with restriction endonucleases BamH Ⅰ, EcoR Ⅰ, Sal Ⅰ respectively, and ligated with the above-mentioned three different sizes of DNA fragments c...
Embodiment 3
[0148] In order to further determine the shortest effective fragment needed for Sphingomonas transformation, improve transformation efficiency, the present invention has carried out following test simultaneously, and draws a result:
[0149]1. Plasmids pHSG398-RepD-1, pHSG398-RepD-2, pHSG398-RepD-3, pHSG398-RepD-4 are transformed on the basis of pHSG398-RepS plasmid, and the preparation method is as follows:
[0150] Using the shuttle plasmid pHSG398‐RepS as a template, pHSGF 1240 TGGCACTGGCCGTCGTTTTACAAC and RepR 1728 CAAGCTTGCGCCTGTTCGCGTCCAGTCCT was the upstream and downstream primers, and after amplification, the plasmid pHSG398-RepD-1 was obtained by self-ligation. The PCR system and steps are as follows:
[0151]
[0152]
[0153] The total reaction volume is 20 μl, pre-denaturation at 98°C for 1 min, denaturation at 98°C for 10 s, annealing at 60°C for 5 s, extension at 72°C for 150 s, 35 cycles, and extension at 72°C for 5 min. After the gel recovery of the am...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap