Watermelon oxysporum pathogenic FonAGL3 gene as well as deleted DNA fragment, deletion mutant and application thereof
A watermelon fusarium wilt pathogen and gene deletion technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of watermelon industry economic losses, environmental pollution, long-term lack of antigens in disease-resistant breeding, etc., to achieve low cost of prevention and control, Environmentally friendly, good effect of Fusarium wilt control
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1: Watermelon Fusarium oxysporum FonAGL3 Obtaining Gene Deletion Mutants
[0050] 1. FonAGL3 Gene deletion DNA fragment construction
[0051] Watermelon Fusarium wilt FonAGL3 Gene knockout adopts the principle of homologous replacement, and replaces the target gene with the DNA fragment of the resistance gene hygromycin B (HPH) gene FonAGL3 DNA fragment, replacement fragment specific sequence vector construction takes as figure 1 , SEQ ID NO.4 ( FonAGL3 Gene and its upstream and downstream sequences, primers required for gene deletion mutation and their positions), SEQ ID NO.5 ( FonAGL3 gene and HPH gene replace part of the sequence ) and SEQ ID NO. 6 (HPH gene). Among them, the primer sequences used in each step in the figure are as follows:
[0052] P1 alg3UF:AGTTTCGTCATCGACAGGTTCC
[0053] P2 alg3UR: TTGACCTCCACTAGCTCCAGCCAAGCCTCTATGTAAG CCCGACCTCT GGT
[0054] P3 alg3DF: ATAGAGTAGATGCCGACCGCGGGTTCGTACTTATATATCTGGTTCGCGT
[0055] P4 alg3DR: ATCGC...
Embodiment 2
[0074] Embodiment 2: FonAGL3 Deletion mutant gene function analysis
[0075] 1. FonAGL3 Deletion mutant pathogenicity assay
[0076] ① Take the cultured 10d FonAGL3 Deletion mutant PDA plate, add 20ml of sterile water to prepare a concentration of 1x10 5 Conidia / ml spore suspension for inoculation experiments;
[0077] ② Take the watermelon seedlings with two leaves and one heart, remove the root matrix and rinse them, cut off some fibrous roots, FonAGL3 Deletion mutant conidia suspensions were soaked in the root for 30 minutes, and then replanted in plug trays. Each strain was inoculated with 35 watermelon seedlings. At 25°C, they were routinely managed, and the incidence was observed. The disease index was calculated; the disease investigation of watermelon seedlings was based on the following classification standards for diseased plants:
[0078] Level 0: The plant is robust, true leaves and cotyledons are green;
[0079] Grade 1: 1 or both cotyledons turn slightly ...
Embodiment 3
[0101] Embodiment three: FonAGL 3. Application of gene deletion mutants in production
[0102] ① Take the cultured 10d FonAGL3 The gene deletion mutant A6325 strain PDA plate was added with 20ml of sterile water, filtered with sterile lens paper, and the conidia of Fusarium wilt was collected and prepared to a concentration of 1×10 5 Conidia / ml spore suspension for inoculation experiments;
[0103] ② 105 high-quality watermelon seeds were soaked in 2% sodium hypochlorite solution for 5 minutes and washed with water. Among them, 70 watermelon seeds were directly sown in the seedling matrix, and 35 watermelon seeds were taken FonAGL3 After the gene deletion mutant A6325 strain was soaked, it was sown in a sterilized substrate, and cultivated at 25°C until the watermelon seedlings had two leaves and one heart;
[0104] ③ Take the watermelon seedlings with two leaves and one heart, remove the root matrix and rinse them. Among them, 35 FonAGL3 Gene deletion mutant A6325 strain...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



