Application of exosome small-molecule RNA to risk assessment of acute myocardial infarction
A technology for acute myocardial infarction and small molecules, applied in the field of medicine and biology, can solve the problems of low specificity of diagnostic indicators, and achieve the effects of convenient material sampling, strong specificity and high reliability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Fluorescence quantitative PCR (QPCR) to verify the differential expression of miRNA
[0042] The miRNA146a-5p, miRNA3135b and miRNA26b-5p are miRNA146a-5p, miRNA3135b and miRNA26b-5p derived from blood exosomes, and their sequences are respectively: SEQ ID NO:1UGAGAACUGAAUUCCAUGGGUU;
[0043] SEQ ID NO: 2GGCUGGAGCGAGUGCAGUGGUG;
[0044] SEQ ID NO: 3UUCAAGUAAUUCAGGAUAGGU.
[0045] Three groups of subjects were selected: 10 normal subjects (N, normal control group); 10 patients with clinical manifestations of angina, but the expressions of ECG, CTNI and CKMB are always negative (DC, disease control group); 10 cases have The clinical manifestations of angina pectoris, the initial expression of ECG, CTNI and CKMB were negative, and patients with coronary heart disease were diagnosed at discharge (ie CTNI and CKMB were positive during hospitalization) (AMI, early myocardial infarction group). Take 2ml of whole blood in each case, centrifuge, separate the plasma, extract t...
Embodiment 2
[0081] Example 2: Analysis of miRNA for early diagnosis of myocardial infarction
[0082] 50 emergency patients were enrolled in the chest pain clinic of Nanshan Hospital, and plasma was collected for simultaneous rapid detection of three miRNAs, cTnI and CKMB for myocardial infarction. The blood collection time is controlled within 2 hours of the onset of chest pain.
[0083] The detection of cTnI and CKMB adopts chemiluminescence immunoassay and the principle of "double antibody sandwich method". The sample detection results are calculated after checking the multi-point calibration curve. Reference range: cTnI> 0.04ng / ml or CK-MB> 6.3ng / ml can be judged as myocardial injury;
[0084] Using the above-mentioned fluorescent quantitative PCR method, reverse transcription of RNA extracted from plasma exosome, quantitative detection of miRNA146a-5p, miRNA3135b, miRNA26b-5p, and obtaining its Ct value, the specific operation is the same as above. At the same time, we detect the Ct value...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


