Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of exosome small-molecule RNA to risk assessment of acute myocardial infarction

A technology for acute myocardial infarction and small molecules, applied in the field of medicine and biology, can solve the problems of low specificity of diagnostic indicators, and achieve the effects of convenient material sampling, strong specificity and high reliability

Active Publication Date: 2017-12-12
CHI BIOTECH CO LTD
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, myoglobin exists not only in cardiomyocytes, but also in various tissues such as skeletal muscle cells, so inflammation, local ischemia, SLE, shock, dermatitis, etc. can also cause MYO to increase, which is used as a diagnostic index for AMI low specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of exosome small-molecule RNA to risk assessment of acute myocardial infarction
  • Application of exosome small-molecule RNA to risk assessment of acute myocardial infarction
  • Application of exosome small-molecule RNA to risk assessment of acute myocardial infarction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Fluorescence quantitative PCR (QPCR) to verify the differential expression of miRNA

[0042] The miRNA146a-5p, miRNA3135b and miRNA26b-5p are miRNA146a-5p, miRNA3135b and miRNA26b-5p derived from blood exosomes, and their sequences are respectively: SEQ ID NO:1UGAGAACUGAAUUCCAUGGGUU;

[0043] SEQ ID NO: 2GGCUGGAGCGAGUGCAGUGGUG;

[0044] SEQ ID NO: 3UUCAAGUAAUUCAGGAUAGGU.

[0045] Three groups of subjects were selected: 10 normal subjects (N, normal control group); 10 patients with clinical manifestations of angina, but the expressions of ECG, CTNI and CKMB are always negative (DC, disease control group); 10 cases have The clinical manifestations of angina pectoris, the initial expression of ECG, CTNI and CKMB were negative, and patients with coronary heart disease were diagnosed at discharge (ie CTNI and CKMB were positive during hospitalization) (AMI, early myocardial infarction group). Take 2ml of whole blood in each case, centrifuge, separate the plasma, extract t...

Embodiment 2

[0081] Example 2: Analysis of miRNA for early diagnosis of myocardial infarction

[0082] 50 emergency patients were enrolled in the chest pain clinic of Nanshan Hospital, and plasma was collected for simultaneous rapid detection of three miRNAs, cTnI and CKMB for myocardial infarction. The blood collection time is controlled within 2 hours of the onset of chest pain.

[0083] The detection of cTnI and CKMB adopts chemiluminescence immunoassay and the principle of "double antibody sandwich method". The sample detection results are calculated after checking the multi-point calibration curve. Reference range: cTnI> 0.04ng / ml or CK-MB> 6.3ng / ml can be judged as myocardial injury;

[0084] Using the above-mentioned fluorescent quantitative PCR method, reverse transcription of RNA extracted from plasma exosome, quantitative detection of miRNA146a-5p, miRNA3135b, miRNA26b-5p, and obtaining its Ct value, the specific operation is the same as above. At the same time, we detect the Ct value...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of small-molecule miRNA146a-5p, miRNA3135b and miRNA26b-5p to preparation of medicines for assessing acute myocardial infarction, application to preparation of medicines for diagnosing acute myocardial infarction, and a kit used for the application. According to the application disclosed by the invention, stable miRNA in exosome is detected, while a molecular marker detected by the traditional method is a protein polypeptide. In quantitative determination, the miRNA has extremely high quantitative precision and sensitivity, and single molecule detection ability can be reached by using an RT-qPCR technology. The application disclosed by the invention has the advantages of being convenient in material selection, simple in operation, high in specificity, rapid and accurate and provides a convenient and rapid screening technology for patients suffering from acute myocardial infarction.

Description

Technical field [0001] The present invention relates to the field of medical biotechnology, in particular to the use of small molecules RNA miRNA146a-5p, miRNA3135b and miRNA26b-5p in the preparation of drugs for the assessment of acute myocardial infarction, the use of drugs for the diagnosis of acute myocardial infarction, and the use of The kit for the purposes described. Background technique [0002] Acute myocardial infarction (AMI) is myocardial necrosis caused by acute and persistent ischemia and hypoxia of coronary arteries. AMI has always been one of the critical diseases of clinical concern. It progresses rapidly and has serious consequences. 1-6 hours after its onset is the golden time for thrombolytic therapy and interventional surgery, and early AMI within 6 hours of rapid diagnosis is the decision to treat. The key link. In recent years, the incidence of myocardial infarction in my country has shown a significant upward trend, with at least 500,000 new cases each ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/158C12Q2600/178
Inventor 董鸣
Owner CHI BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com