Attenuated, brightened and replication-controllable HSV recombinant virus, preparation method and applications thereof
A technology for recombining viruses and viral genomes, applied in the directions of botanical equipment and methods, biochemical equipment and methods, applications, etc., can solve the problems of high toxicity and weak sensitivity, and achieve the effect of reducing toxicity and widening the host range.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] TK knockout, targeted shuttle plasmid carrying exogenous genes flexibly, its construction method is as follows:
[0055] In order to construct a recombinant virus with a deletion of the TK gene, firstly, according to the H129 genome sequence queried by NCBI (GenBank: GU734772.1), primers were designed to clone the homology arm sequences on both sides of the TK gene, without retaining any TK CDS sequence. Select and clone the upstream homology arm sequence 1465bp, and the downstream homology arm sequence 1476bp.
[0056] Extract and purify HSV-1H129 virus genomic DNA, use it as a template, such as figure 1 As shown, the cloned upstream homologous arm fragment is 1465bp, and the primers used are UHAS-F: 5'GCTAGCAGTGGGCCAAAAAGCCTAGC 3'; UHAS-R: 5'AAGCTTACGCACGGGTGTTGGGTCGTTTG 3'; the cloned downstream homologous arm fragment is 1476bp long, and the primers used are DHAS-F: 5'AAGCTTGTTCGAGGCCACACGCGTCAC 3'; DHAS-R: 5'CTCGAGGGGAAAGTCCGTGATGGTGC 3'; Due to the high GC conten...
Embodiment 2
[0059] Cloning of high-abundance expression cassettes of exogenous genes and construction of insertion targeting vectors, the steps are as follows:
[0060] The exogenous gene expression cassette is inserted into the targeting vector containing the homology arm sequence through the multiple cloning site linker. In order to achieve high-abundance expression of exogenous genes, the promoter selects the ubiquitin promoter that efficiently initiates transcription. The ubiquitin system widely exists in eukaryotes, and the ubiquitin promoter in its gene family can significantly enhance the long-term expression of genes , stability, and basically not limited by tissue cells. At the same time, the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) was introduced downstream of the gene ORF. WPRE can stabilize RNA and significantly enhance the expression ability of foreign proteins. In order to prepare H129tracer for tracing neural circuits, the fluorescent report...
Embodiment 3
[0064] Acquisition of HSV recombinant virus with attenuated brightening and controllable replication:
[0065] Extract the targeting shuttle vector pH129ΔTK-hUbC-EGFP-WPRE-PA or pH129ΔTK-hUbC-tdTomato-WPRE-PA, and co-transfect HEK 293T cells with the extracted H129 virus genome after digestion and linearization, and change the medium after 6 hours to contain 2% fetal bovine serum maintenance medium; observe that all cells become round and lesions (generally 24-48 hours after infection), collect the samples and place them in a -80°C refrigerator; after three times of repeated freezing and thawing, centrifuge at 6500g for 10 minutes to remove cell debris, Take 10 μl of virus supernatant to infect Vero cells, and observe whether the infected cells have fluorescent expression after 1 day to determine whether the new virus is successfully recombined; later, take the recombined virus supernatant and infect Vero cells after continuous 10-fold gradient dilution, and spread agar after 1...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap