Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Primer, kit and method for detecting gene mutation of blood coagulation factor XII (F12)

A blood coagulation factor, F12 technology, applied in the field of life science and biology, can solve the problem of ineffective secretion

Inactive Publication Date: 2018-03-27
南京艾迪康医学检验所有限公司
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Oguchi S et al. conducted mutation analysis and in vitro transfection analysis on congenital coagulation factor XII deficiency cases from Japan, and found that factor XII Ala392Thr mutant protein can be synthesized intracellularly, but cannot be effectively secreted extracellularly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, kit and method for detecting gene mutation of blood coagulation factor XII (F12)
  • Primer, kit and method for detecting gene mutation of blood coagulation factor XII (F12)
  • Primer, kit and method for detecting gene mutation of blood coagulation factor XII (F12)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0119] A primer for detecting the polymorphic mutation site of the coagulation factor XII (F12) gene, the design of the primer is an amplification primer designed for the whole exon of the coagulation factor XII (F12), including:

[0120] The primers for amplifying the whole exon sequence of blood coagulation factor XII (F12) gene, its base sequence is:

[0121] XII E1 F: TGTAAAACGACGGCCAGTAAGGAAGTTGCTCCACTTGGC

[0122] XII E1 R: AACAGCTATGACCATGCATGGCTCATGGCTGTGATA

[0123] XII E2 F: TGTAAAACGACGGCCAGTGGAAGCTGCAGACTAGCAACAGA

[0124] XII E2 R: AACAGCTATGACCATGACCTAGCACCAGGTAGGCACTA

[0125] XII E3 F: TGTAAAACGACGGCCAGTCTTTTTCCTGACCAGACCCTGAG

[0126] XII E3 R: AACAGCTATGACCATGAGCAGAGTTCCTTGGACAGAAGG

[0127] XII E4 F: TGTAAAACGACGGCCAGTAGGAACTCTGCTTGGAGAGAG

[0128] XII E4 R: AACAGCTATGACCATGCCAGAATCCCAGGTGTGTGG

[0129] XII E5 F: TGTAAAACGACGGCCAGTAGGTTCAAGAAGGGCCTTGGC

[0130] XII E5 R: AACAGCTATGACCATGCAACCTATTCTGTAGGCCCAGGG

[0131] XII E6 F: TGTAAAACGACGGCCAGTTTG...

Embodiment 2

[0158] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):

[0159] Tissue DNA extraction from human blood:

[0160] 1) Take 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed.

[0161] 2) Add 20 μl proteinase K solution and mix well.

[0162] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0163] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0164] 5) Add the solution and f...

Embodiment 3

[0171] The blood sample DNA extracted according to Example 2 was then used to amplify the whole exon of blood coagulation factor XII (F12) using the amplification primers in Example 1. Amplification was carried out on a conventional PCR instrument, and the details are as follows:

[0172] Take clinical samples, extract genome, prepare reagents and detect according to the method described in Example 2. At the same time, make positive, negative, and blank controls.

[0173] (1) Reagent configuration: configure each Xμl of the detection system PCR reaction solution according to the number of people to be tested, and pack in 18μl per person:

[0174] X = 18 μl reaction solution × (n samples + 1 positive control + 1 negative control + 1 blank control)

[0175] n is the number of samples tested.

[0176](2) Adding samples: add 2 μl DNA to the PCR reaction solution of the detection system; directly add 2 μl positive control substance and negative control substance to the positive ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and a method for detecting gene mutation related to congenital deficiency of blood coagulation factor XII. The method comprises the following steps: performing amplification testing on 14 pairs of primers in a whole-exome sequence in a hot spot region of blood coagulation factor XII (F12); and adopting Sanger sequencing techniques and sequencing primers. Accordingto the primer and method disclosed by the invention, mutation of genes related to the congenital deficiency of blood coagulation factor XII can be rapidly detected. The method disclosed in the invention has accurate results, is capable of aiding diagnosis of the congenital deficiency of blood coagulation factor XII and has important reference significance on early intervention, early treatment andantenatal diagnosis.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and particularly relates to a primer and a method for detecting gene mutations related to hereditary blood coagulation factor XII (F12). Background technique [0002] Congenital coagulation factor XII deficiency or Hageman characteristic is an autosomal recessive inheritance with a history of consanguineous marriage, and both men and women can be affected. Coagulation factor XII is the first coagulation factor activated in the coagulation reaction. Activated coagulation factor XII (FXIIa) activates coagulation factor XI during the coagulation process, and also activates the fibrinolytic system to enhance vascular permeability. Inhibitors of FXIIa in vivo include activated complement C1 inhibitors, plasminogen activator inhibitors and antithrombin III (AT-III). Heparin can accelerate the inhibitory effect of AT-III on FXIIa. Coagulation factor XII is in an inactive state in plasma, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6883C12Q2600/156C12Q2531/113C12Q2535/101
Inventor 黄开新刘赵玲王淑一
Owner 南京艾迪康医学检验所有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com