Specific human gene fragment, primer and probe for detecting specific human gene fragment and application of specific human gene fragment

A gene fragment and probe technology, used in the field of pharmacokinetic biodetection, can solve the problems of inability to correspond to cell mass, high non-specific ligation products, difficult absolute quantification of qPCR, etc., and achieve accurate and sensitive detection, strong sensitivity, Accurate effect

Active Publication Date: 2018-04-20
浙江泉生生物科技有限公司
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existing detection system mainly has the following defects: 1. The standard plasmid construction process is cumbersome: generally, intermediate plasmids are required for amplification, or enzyme digestion and recovery are required after cloning to connect the target vector; 2. The standard plasmid construction efficiency is not high enough: The standard plasmid constructed by linking the target sequence with the target vector often has high non-specific ligation products; 3. The calculation of the molar molecular weight of the standard plasmid is not accurate enough: usually the average of the four bases of ATCG is multiplied by the base number of the constructed plasmid The molecular weight is estimated; 4. The drawing of the standard curve is not accurate enough: the dilution factor of the standard plasmid is not enough, and the standard products used to draw the standard curve are too few (generally only about 5); copy, and the copy numbers in different parts are slightly different, which cannot correspond to the cell volume well; at the same time, because the ALU multi-copy sequence is short, it is not suitable to design corresponding primer probes, and it is difficult to use qPCR for absolute quantification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific human gene fragment, primer and probe for detecting specific human gene fragment and application of specific human gene fragment
  • Specific human gene fragment, primer and probe for detecting specific human gene fragment and application of specific human gene fragment
  • Specific human gene fragment, primer and probe for detecting specific human gene fragment and application of specific human gene fragment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Acquisition of Specific Human Gene Fragments

[0036] 1.1 Acquisition of the full-length sequence of the target gene

[0037] In Genome, a sub-site of the NCBI website, search for possible specific gene names of human origin, such as figure 1 As shown, click on GenBank to obtain the full-length sequence of the target gene on the genome of different species.

[0038] 1.2 Comparison of target genes among different species

[0039] Also on the NCBI website, use the nucleic acid comparison function in its sub-site BLAST to input the genome sequences of the same target gene in different species, such as figure 2 As shown, after the comparison analysis, the sequence difference information of the target gene among different species can be obtained.

[0040] 1.3 Selection of specific human gene fragments

[0041]On the basis of the comparison analysis in 1.2, find the region with the greatest difference between the human gene and other animal gene sequences, such...

Embodiment 2

[0042] Design synthesis and verification of embodiment 2 primer probe

[0043] 2.1 Design of human-specific primer probes

[0044] Use the software Premier primer 5 to design high-quality primer probes on the selected target fragments. The general principle is that the primer sequence is 18-25bp, the Tm value is 50-60°C, and the GC content is 40-60%; the corresponding probe is at the end close to the primer, and the Tm value is about 10°C higher than that of the primer.

[0045] 2.2 Theoretical analysis of human-specific primers and probes

[0046] First, input the designed pair of primers into the Primer BLAST under the BLAST sub-site of the NCBI website, such as Figure 4 As shown, then, select the properties of the primers to be detected, such as on the genome, which species, etc., such as Figure 5 As shown; click Getprimer to obtain the detection results. It can be seen that in many animal species, the designed primers can only specifically recognize the human genome s...

Embodiment 3

[0049] The construction of embodiment 3 standard plasmid and the drafting of standard curve

[0050] 3.1 Construct a standard plasmid containing the target sequence:

[0051] The theoretical analysis and experimental test results in Example 2 prove that the target sequence can be used to specifically detect human cells (genome fragments), therefore, the target sequence can be connected to the target vector to construct a standard plasmid.

[0052] 3.1.1 Synthetic primers:

[0053] Sense: GTAGGTCGTATATTGGATTG, namely the base sequence of primer-F shown in SEQ ID NO.2.

[0054] Anti-sense: AGGTGTGTTTAATGTAGC, namely the base sequence of primer-R shown in SEQ ID NO.3.

[0055] 3.1.2 Clone target sequence (BIO-RAD PCR instrument):

[0056] Reaction system: PrimeStar MAX(25ul) / 5umol Primers(F+R)2ul / human genome DNA(200ng) / H2O up to 50ul

[0057] Reaction conditions: 98°C for 5min, 98°C for 15s, 49°C for 30s, 72°C for 20s, 12°C forever, 36 cycles

[0058] 3.1.3 Running glue cut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific human gene fragment, a primer and a probe for detecting the specific human gene fragment and application of the specific human gene fragment, and particularly discloses a method comprising the following steps: screening the human specific gene fragment, designing, synthesizing and verifying the specific primer probe, constructing a standard plasma and acquiring the accurate relative molecular mass, drawing a standard curve and finally conducting qPCR (Polymerase Chain Reaction) quantitative detection. Therefore, the most important characteristic of the specific human gene fragment lies in that due to the quite strong specificity of the probe and the primer, a human cell in a sample mixed with other animal sources can be qualitatively and quantitatively detected; a carrier T5 is also known for the first time to be used in the construction of the standard plasma, the time is saved, and the cost is also lowered; and the various steps of a method are optimized, so that the detection is more accurate and sensitive.

Description

technical field [0001] The invention belongs to the technical field of biological detection of pharmacokinetics, in particular to a specific human gene fragment and its primer, probe and application. Background technique [0002] Since its official birth in 1985, PCR technology has been widely recognized by the life science community. After decades of continuous improvement, the PCR method has developed from a qualitative analysis method to a quantitative detection method. From the original gene that can only amplify a few kb to the present, it can amplify DNA fragments up to dozens of kb. So far, there have been more than a dozen PCR techniques, which have become the fundamental cornerstone of genetics and molecular biology. Among the many technologies, the real-time fluorescent quantitative PCR (qPCR) technology, which came out in 1996, is the most widely used. It is the most advanced nucleic acid molecular diagnostic technology for clinical use in the world today, and is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/11C12N15/63C12Q1/6851
CPCC07K14/47C12Q1/6851C12Q1/6888C12Q2600/166C12Q2545/114C12Q2531/113
Inventor叶石成王皓钟熊齐念民
Owner浙江泉生生物科技有限公司