Genetic marker relevant to high altitude hypoxia adaptability of Tibetan sheep and application of genetic marker
A plateau hypoxia and genetic marker technology, applied in the field of genetic markers
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] 1 Test materials and methods
[0031] 1.1 Experimental animals and sample collection
[0032] A total of 340 Tibetan sheep blood samples were collected. 8-10 mL of blood was collected from the jugular vein, anticoagulated with heparin sodium anticoagulant, and stored in the laboratory at -20°C for later use. Part of the blood was dropped onto the FTA card to dry and stored at room temperature.
[0033] 1.2 Test method
[0034] 1.2.1 Genomic DNA and total RNA extraction
[0035] Genomic DNA extraction: DNA extraction kit Easy from Beijing Quanshijin Biotechnology Co., Ltd. The Blood Genomic DNA Kit and the two-step method described by Zhou et al.
[0036] 1.2.2 PCR amplification of PPARα gene
[0037] According to the sheep PPARα gene sequence provided by NCBI (accession number: NC_019460.2), the specific primer P1 (Table 1) was designed using PrimerPrimer5.0 and DNAMAN, and the primer was synthesized by Huada Gene Technology Co., Ltd.
[0038] Table 1 Primer P1 ...
Embodiment 2
[0079] PCR-SSCR kit of the present invention comprises:
[0080] 1. Primer pair
[0081] Upstream primer: P1-up: ATGTTCGCCCACAGTTTGAC
[0082] Downstream primer: P1-dn: TGCTACGACTCTAGCTGACG.
[0083] 2. PCR reaction system
[0084] The 20 μL PCR reaction system is: 10 μL Taq premixed enzyme (Nanjing Novizan Biotechnology Co., Ltd.), deionized water (ddH 2 O) 7.6 μL, each 0.8 μL of upstream and downstream primers and DNA template.
[0085] 3. SSCP loading denaturation buffer (including 98% deionized formamide, 0.025% bromophenol blue, 0.025% xylene cyanol, 10mmol / L EDTApH 8.0)
[0086] 4. Standard sample
[0087] Standard sample A: its nucleotide sequence is SEQ ID No.1 in the sequence listing;
[0088] Standard sample B: its nucleotide sequence is SEQ ID No.2 in the sequence listing.
[0089] Refer to Example 1 for the usage method of the kit.
[0090] Compare the SSCP electrophoresis band pattern of the sample to be tested with the SSCP electrophoresis band pattern of...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap