Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genetic marker relevant to high altitude hypoxia adaptability of Tibetan sheep and application of genetic marker

A plateau hypoxia and genetic marker technology, applied in the field of genetic markers

Active Publication Date: 2018-05-04
GANSU AGRI UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are few reports on the adaptation of PPARα gene to hypoxia in Tibetan sheep plateau

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic marker relevant to high altitude hypoxia adaptability of Tibetan sheep and application of genetic marker
  • Genetic marker relevant to high altitude hypoxia adaptability of Tibetan sheep and application of genetic marker
  • Genetic marker relevant to high altitude hypoxia adaptability of Tibetan sheep and application of genetic marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] 1 Test materials and methods

[0031] 1.1 Experimental animals and sample collection

[0032] A total of 340 Tibetan sheep blood samples were collected. 8-10 mL of blood was collected from the jugular vein, anticoagulated with heparin sodium anticoagulant, and stored in the laboratory at -20°C for later use. Part of the blood was dropped onto the FTA card to dry and stored at room temperature.

[0033] 1.2 Test method

[0034] 1.2.1 Genomic DNA and total RNA extraction

[0035] Genomic DNA extraction: DNA extraction kit Easy from Beijing Quanshijin Biotechnology Co., Ltd. The Blood Genomic DNA Kit and the two-step method described by Zhou et al.

[0036] 1.2.2 PCR amplification of PPARα gene

[0037] According to the sheep PPARα gene sequence provided by NCBI (accession number: NC_019460.2), the specific primer P1 (Table 1) was designed using PrimerPrimer5.0 and DNAMAN, and the primer was synthesized by Huada Gene Technology Co., Ltd.

[0038] Table 1 Primer P1 ...

Embodiment 2

[0079] PCR-SSCR kit of the present invention comprises:

[0080] 1. Primer pair

[0081] Upstream primer: P1-up: ATGTTCGCCCACAGTTTGAC

[0082] Downstream primer: P1-dn: TGCTACGACTCTAGCTGACG.

[0083] 2. PCR reaction system

[0084] The 20 μL PCR reaction system is: 10 μL Taq premixed enzyme (Nanjing Novizan Biotechnology Co., Ltd.), deionized water (ddH 2 O) 7.6 μL, each 0.8 μL of upstream and downstream primers and DNA template.

[0085] 3. SSCP loading denaturation buffer (including 98% deionized formamide, 0.025% bromophenol blue, 0.025% xylene cyanol, 10mmol / L EDTApH 8.0)

[0086] 4. Standard sample

[0087] Standard sample A: its nucleotide sequence is SEQ ID No.1 in the sequence listing;

[0088] Standard sample B: its nucleotide sequence is SEQ ID No.2 in the sequence listing.

[0089] Refer to Example 1 for the usage method of the kit.

[0090] Compare the SSCP electrophoresis band pattern of the sample to be tested with the SSCP electrophoresis band pattern of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetic marker relevant to the high altitude hypoxia adaptability of Tibetan sheep. The genetic marker is positioned on a PPAR (peroxisome proliferator activated receptor) alpha gene, and a concrete nucleotide sequence is as shown in a sequence table SEQ ID No. 1; in the nucleotide sequence of the sequence table SEQ ID No. 1, when an allelic gene is A, the high altitude hypoxia adaptability of the Tibetan sheep is poor; when the allelic gene is B, the high altitude hypoxia adaptability of the Tibetan sheep is good. The Tibetan sheep are taken as research objects, a PCR(Polymerase Chain Reaction)-SSCP (single-stranded conformational polymorphism) method is adopted to combine with DNA (deoxyribonucleic acid) sequencing technology so as to research the genetic variation characteristics of PPAR alpha genes of 2 sheep groups, and in the high altitude hypoxia adaptability, the molecular markers of the Tibetan sheep are initially screened out to provide foundation for subsequent relativity analyses.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and molecular biology, and specifically relates to a genetic marker related to Tibetan sheep plateau hypoxic adaptability and its application. Background technique [0002] The average altitude of the Qinghai-Tibet Plateau is above 4,500m, and it has extreme environmental characteristics such as low oxygen, cold, and strong ultraviolet rays. The plateau indigenous species bred in such harsh natural environmental conditions are excellent "materials" for us to carry out research on animal adaptive evolution. Indigenous plateau animals such as wild yak, Tibetan sheep, and Tibetan antelope have undergone a long period of adaptive evolution, and have continuously formed adaptation and regulation mechanisms at the morphological, cellular, and molecular levels. With the rapid development of genomics and bioinformatics, the methods and tools for analyzing biological adaptive evolution based on...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888
CPCC12Q1/6888C12Q2600/124
Inventor 刘秀罗玉柱李少斌王继卿张亚强王凤璋
Owner GANSU AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com