A high-throughput method for screening and detecting transgenic elements

A detection method and genetic element technology, applied in the field of molecular biology, to achieve the effects of reducing the probability of error, stabilizing the detection method, and saving costs

Active Publication Date: 2020-12-15
HUAZHI RICE BIO TECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, there is no report on the use of KASP technology to screen and detect high-throughput transgenic elements in crops

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A high-throughput method for screening and detecting transgenic elements
  • A high-throughput method for screening and detecting transgenic elements
  • A high-throughput method for screening and detecting transgenic elements

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1 Application of the method of the present invention detects whether the corn sample contains NOS Terminator Transgenic Components

[0047] 1. Preparation of DNA template

[0048] Using the DNA extraction method of TPS or CTAB, DNA was extracted from 101 corn leaves as templates for PCR reactions. Prepare the template for the control at the same time: the positive control contains NOS Terminator transgenic maize and containing NOS The plasmid of the terminator, the negative control is non-transgenic corn, and the blank control is sterile ultrapure water.

[0049] 2. Design and synthesis of primers

[0050] Designed according to the sequence of gene fragments in Genbank NOS terminators (Table 1) and maize endogenous genes ZSSIIb Specific amplification primers (Table 2). exist NOS Adding a FAM tag sequence to the 5' end of the terminator forward primer becomes "GAAGGTGACCAAGTTCATGCTCAGTGGTCCCAAAGATGGAC"; in ZSSIIb A HEX tag sequence was added to the ...

Embodiment 2

[0062] The pairing combination of embodiment 2 primers

[0063] When using the method of the present invention for detection, a pair of transgenic element primers and a pair of endogenous gene primers are added to the reaction system. How to ensure that the primers of the two genes do not interfere with each other becomes a difficulty in this application. Through experiments, a series of primer pairs were screened out (Table 5). These paired primers were validated against known negative and positive samples. The specific experimental steps are as follows:

[0064] (1) Prepare DNA templates: prepare DNA from non-transgenic samples, plant sample DNA containing transgenic elements, and E. coli plasmid DNA containing transgenic elements.

[0065] (2) Construct the reaction system: transgenic element primer (FAM tag sequence added to the 5' end of the forward primer), endogenous gene primer (HEX tag sequence added to the 5' end of the forward primer), KASP Master Mix, and DNA tem...

Embodiment 3

[0070] Example 3 The accuracy of high-throughput detection using the method of the present invention.

[0071] When using the method of the present invention to detect a large number of samples, it becomes a difficult point in this application to clearly distinguish positive and negative samples on the scatter diagram of the scanning results. In order to determine the effect of using the method of the present invention to carry out high-throughput detection on a large number of samples, 384 known negative and positive samples are detected with KPM743, KPM119, and KPM588 in Table 5 as examples, and the detection results are compared with the genotypes of the samples themselves , to verify the accuracy of the method for detecting a large number of samples. The specific experimental steps are as follows:

[0072] (1) Prepare DNA template: prepare DNA from non-transgenic plant samples, containing 35S promoter or NOS DNA from plant samples for terminators, E. coli plasmids conta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a high-throughput transgenosis element screening test method based on kompetitive allele specific PCR (KASP). The test method comprises the following steps: (1) designing primers of a transgenosis element and primers of an endogenous gene; (2) extracting deoxyribonucleic acid (DNA) of a sample; (3) using the primers of the transgenosis element, the primers of the endogenousgene, KASP reaction liquid and the DNA of the sample to carry out a PCR reaction so as to determine whether the sample contains the transgenosis element or not. When being used for performing a transgenosis element screening test on a plant sample, the method has the advantages of being high in efficiency, low in lowcost, high in accuracy rate, easy to operateion, and the like.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a method for screening and detecting high-throughput transgenic elements based on KASP (competitive allele PCR) technology. Background technique [0002] Molecular detection of genetically modified crops and their products is the basis of safety management of genetically modified organisms. At present, our country only approves the planting of some genetically modified cotton, poplar, and papaya. The normalized screening and testing of genetically modified elements on crops is conducive to the effective supervision of the planting of genetically modified crops by the relevant departments of our country. [0003] The screening detection of transgenic elements is mainly aimed at the detection of transgenic elements including promoters, terminators, and screening marker genes. At present, the commonly used detection methods of genetically modified crops include detection methods b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895
Inventor杨翅春郑秀婷熊艳文彭佩李文博
OwnerHUAZHI RICE BIO TECH CO LTD