shRNA for inhibiting bovine MSTN gene expression, construction vector and application thereof
An expression vector and gene expression technology, applied in the field of molecular biology, can solve the problems of short duration and low siRNA transfection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1ShRNA carrier construction
[0032] According to the multiple cloning site of pSilencer 4.1-CMV (commercially available plasmid), combined with the complete sequence of the MSTN gene, the target sequence was searched in the coding region (Coding Sequence, CDS) of the MSTN gene, and the online siRNA design software (WhiteHead) was used. Interference RNA design principles, preliminary design selection, and BLAST (Basic Local Alignment Search Tool) comparison with NCBI genebank to remove sequences with high homology to gene fragments of other species; and search for relevant literature principles, so that the design is successful High rate.
[0033] According to the above steps, the following four shRNA sequences were preliminarily designed:
[0034] ShRNA name
ShRNA sequence
bMSTN-shRNA1
GGGCTGTGTAATGCATGTTTG
bMSTN-shRNA2
TACAAAGATGTCTCCAATTAA
bMSTN-shRNA3
ACTGCAAATCTCTGTTTATAT
bMSTN-shRNA4
GCACTGGTATT...
Embodiment 2
[0074] Embodiment 2 plasmid transfection
[0075] Experimental Materials
[0076] 1) Clean bench, 2) Biological safety cabinet, 3) Research grade inverted microscope, 4) Refrigerated centrifuge, 5) Carbon dioxide incubator, 6) Stereo mirror, 7) DMEM complete medium, 8) 1×PBS, 9) Trypsin-EDTA, 10) 4 shRNA lentiviral vectors and an empty control lentiviral vector, 11) MSTN overexpression vector, 12) transfection reagent, 13) bovine kidney cells, 14) 293T cells.
[0077] 1. Plank
[0078] Spread the 293T cells on a 10cm culture dish, wait for the cells to adhere to the wall, and the cell density before transfection is preferably 60%-70%, and replace with fresh medium (DMEM+10%FBS).
[0079] 2. Transfection
[0080] 2.1. Mixing of plasmids and transfection reagents: Prepare 6 EP tubes, add 500 μL of normal saline to each, corresponding to the overexpression plasmid, 4 shRNA-inserted plasmids and 1 empty plasmid, 7-8 μg of each plasmid, After resting for 10 minutes, add 18 μL o...
Embodiment 3
[0085] Experimental Materials
[0086] 1) ABI7500 fluorescent quantitative PCR instrument (life technology company), 2) TGL-16M low temperature refrigerated centrifuge (Xiangyi), 3) SW-CJ-1D single-person purification workbench (Lujing purification), 4) HR40-ⅡA2 Biological safety cabinet (Haier), 5) SMA4000 ultra-micro spectrophotometer (Merinton), 6) 96-well plate (US life technology), 7) 5 cell samples, 8) primers (synthesized by life technology company), 9) BestarTM qPCRRT Kit (Germany DBI article number: DBI-2220), 10) SybrGreen qPCR mastermix (German DBI catalog number: DBI-2043).
[0087] 1. Extraction of RNA
[0088] RNA was extracted according to the instructions of Triozol provided by life technology company. The procedure is as follows:
[0089] (1) Add 1ml TRIzol to the cell culture plate, pipette it several times, then suck it out, and put it in a 1.5ml centrifuge tube;
[0090] (2) Add 0.2mL chloroform, cap the centrifuge tube tightly, mix upside down for 60...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


