Unlock instant, AI-driven research and patent intelligence for your innovation.

shRNA for inhibiting bovine MSTN gene expression, construction vector and application thereof

An expression vector and gene expression technology, applied in the field of molecular biology, can solve the problems of short duration and low siRNA transfection efficiency

Active Publication Date: 2018-06-05
LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The shRNA lentiviral expression system effectively overcomes the shortcomings of the artificially synthesized siRNA in the past, such as low transfection efficiency and short duration, and has gradually developed into one of the effective ways to study gene function in primary cells and in vivo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • shRNA for inhibiting bovine MSTN gene expression, construction vector and application thereof
  • shRNA for inhibiting bovine MSTN gene expression, construction vector and application thereof
  • shRNA for inhibiting bovine MSTN gene expression, construction vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1ShRNA carrier construction

[0032] According to the multiple cloning site of pSilencer 4.1-CMV (commercially available plasmid), combined with the complete sequence of the MSTN gene, the target sequence was searched in the coding region (Coding Sequence, CDS) of the MSTN gene, and the online siRNA design software (WhiteHead) was used. Interference RNA design principles, preliminary design selection, and BLAST (Basic Local Alignment Search Tool) comparison with NCBI genebank to remove sequences with high homology to gene fragments of other species; and search for relevant literature principles, so that the design is successful High rate.

[0033] According to the above steps, the following four shRNA sequences were preliminarily designed:

[0034] ShRNA name

ShRNA sequence

bMSTN-shRNA1

GGGCTGTGTAATGCATGTTTG

bMSTN-shRNA2

TACAAAGATGTCTCCAATTAA

bMSTN-shRNA3

ACTGCAAATCTCTGTTTATAT

bMSTN-shRNA4

GCACTGGTATT...

Embodiment 2

[0074] Embodiment 2 plasmid transfection

[0075] Experimental Materials

[0076] 1) Clean bench, 2) Biological safety cabinet, 3) Research grade inverted microscope, 4) Refrigerated centrifuge, 5) Carbon dioxide incubator, 6) Stereo mirror, 7) DMEM complete medium, 8) 1×PBS, 9) Trypsin-EDTA, 10) 4 shRNA lentiviral vectors and an empty control lentiviral vector, 11) MSTN overexpression vector, 12) transfection reagent, 13) bovine kidney cells, 14) 293T cells.

[0077] 1. Plank

[0078] Spread the 293T cells on a 10cm culture dish, wait for the cells to adhere to the wall, and the cell density before transfection is preferably 60%-70%, and replace with fresh medium (DMEM+10%FBS).

[0079] 2. Transfection

[0080] 2.1. Mixing of plasmids and transfection reagents: Prepare 6 EP tubes, add 500 μL of normal saline to each, corresponding to the overexpression plasmid, 4 shRNA-inserted plasmids and 1 empty plasmid, 7-8 μg of each plasmid, After resting for 10 minutes, add 18 μL o...

Embodiment 3

[0085] Experimental Materials

[0086] 1) ABI7500 fluorescent quantitative PCR instrument (life technology company), 2) TGL-16M low temperature refrigerated centrifuge (Xiangyi), 3) SW-CJ-1D single-person purification workbench (Lujing purification), 4) HR40-ⅡA2 Biological safety cabinet (Haier), 5) SMA4000 ultra-micro spectrophotometer (Merinton), 6) 96-well plate (US life technology), 7) 5 cell samples, 8) primers (synthesized by life technology company), 9) BestarTM qPCRRT Kit (Germany DBI article number: DBI-2220), 10) SybrGreen qPCR mastermix (German DBI catalog number: DBI-2043).

[0087] 1. Extraction of RNA

[0088] RNA was extracted according to the instructions of Triozol provided by life technology company. The procedure is as follows:

[0089] (1) Add 1ml TRIzol to the cell culture plate, pipette it several times, then suck it out, and put it in a 1.5ml centrifuge tube;

[0090] (2) Add 0.2mL chloroform, cap the centrifuge tube tightly, mix upside down for 60...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to shRNA for inhibiting bovine MSTN gene expression, a construction vector and application thereof and belongs to the technical field of molecular biology. DNA sequences coding the shRNA are shown as SEQ ID NO 1-4. The application comprises the following steps: constructing shRNA for inhibiting bovine MSTN gene expression on a vector to obtain a recombinant vector containingthe shRNA; and acting the recombinant vector containing the shRNA on cells, thereby achieving an aim of inhibiting the bovine MSTN gene expression. The shRNA is capable of effectively inhibiting the expression of bovine MSTN genes on mRNA and protein levels.

Description

technical field [0001] The invention relates to an shRNA for inhibiting the expression of bovine MSTN gene, a construction carrier and application thereof, and belongs to the technical field of molecular biology. Background technique [0002] Myostatin, also known as GDF-8 (growth differentiation factor 8), belongs to the TGF-β (transforming growth factor beta transforming growth factor G) superfamily and is a type of glycoprotein widely expressed in skeletal muscle. Changes in muscle may change the fiber composition of the muscle (the ratio of red and white muscle) and cause changes in muscle weight by regulating the expression of target genes. Since it was discovered that myostatin can regulate the growth of skeletal muscle, due to its potential application value in medical health, animal husbandry and aquaculture, the research work in this direction has progressed rapidly, and the research on this gene has attracted much attention. [0003] The protein encoded by the MST...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/85C12N15/86C12N5/10
CPCC12N15/1136C12N2310/531
Inventor 褚敏熊琳吴晓云阎萍梁春年丁学智郭宪裴杰王宏博包鹏甲席斌
Owner LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS