Supercharge Your Innovation With Domain-Expert AI Agents!

Molecular marker TJcM02 for identifying separate flowers of muskmelons and application thereof

A molecular marker, unisexual flower technology, applied in the biological field, can solve the problems of high cost, low efficiency, long life, etc., and achieve the effect of high accuracy, good specificity, and accurate distinction.

Inactive Publication Date: 2018-07-03
TIANJIN UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the problems existing in the current breeding of unisexual melons, such as long years, low efficiency and high cost, the present invention provides a TJcM02 molecular marker for identifying unisexual flowers of melons and its special primers. Reaction, the distinction between parthenogenetic female flowers and non-parthenogenetic female flowered melon materials can be completed in the early stage of the melon plant, which has the advantages of good specificity, high accuracy, and is not affected by the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker TJcM02 for identifying separate flowers of muskmelons and application thereof
  • Molecular marker TJcM02 for identifying separate flowers of muskmelons and application thereof
  • Molecular marker TJcM02 for identifying separate flowers of muskmelons and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1, the acquisition of molecular markers

[0031] The melon gene CmACS-7 is an important regulatory factor for regulating the flower type of melon. Using the resequencing information of the melon genome, an InDel molecular marker TJcM02 was obtained in the region near the position of the gene, and its sequence is shown in sequence 1 in the sequence listing. In order to utilize the InDel site, suitable specific primers were designed, including upstream primer F and downstream primer R, and the primer sequences are as follows:

[0032] Upstream Primer F: TTCAAATTCTTCACAACTTTACCGTATTGATCC

[0033] Downstream primer R: GGTGGTCATTTTCATAGAACTTTCCCATAC

Embodiment 2

[0034] Example 2, the acquisition of melon materials Oa831, Oa808 and F2 generation segregated populations and the identification of material flower types

[0035] The melon material Oa831 is the female parent, and Oa808 is the male parent. The F1 generation is obtained by crossing, and the F2 generation melon material is obtained by selfing the F1 generation. Cultivate normally in the field, and observe the flower type of the materials at the flowering stage. According to whether the open flowers contain stamens and pistils, it is determined that Oa831 is a unisexual flower material, Oa808 is a bisexual flower material, F1 generation is a unisexual flower material, 44 plants Among the F2 muskmelon plants, 39 plants showed unisexual female floral material, and 5 plants showed hermaphrodite flower material.

Embodiment 3

[0036] Example 3, the application of molecular markers in identifying whether the muskmelon is unisexual female flowered melon

[0037]For the melon material in Example 2, use the CTAB method to extract the genomic DNA of the leaves. The specific steps are: take 0.2 g of young melon leaves and put them into a 1.5 mL centrifuge tube, add 50 μL of 2% CTAB extraction buffer, grind, and then add Make up to 400 μL, bathe in 65°C water for 30 minutes; add 400 μL of chloroform:isoamyl alcohol (24:1), and shake gently for 5 minutes. Centrifuge at 12,000 rpm for 5 minutes; take 200 μL of supernatant, add 200 μL of pre-cooled isopropanol to mix, and place at -20°C for 20 min; centrifuge at 12,000 rpm for 10 min; discard supernatant, add 150 μL of pre-cooled ethanol, mix gently and wash, 10,000 Centrifuge at rpm for 5 min; discard the supernatant, air dry or blow dry; add 100 μL of distilled water to dissolve the DNA, and place at room temperature for 1 h; dilute the DNA to 50 ng / μL with...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker TJcM02 for identifying separate flowers of muskmelons and an application thereof. In order to solve the problems in breeding of existing unisexual female flower muskmelons, for example, long time, low efficiency and high cost, the invention provides the molecular marker TJcM02 for identifying separate flowers of muskmelons and special primers. Through a polymerase chain reaction, unisexual female flowers and non unisexual female flowers are differentiated in the early stage of muskmelon plants, so that the molecular marker has the advantages of good specificity and high accuracy, and is not affected by environment.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular marker TJcM02 for identifying unisexual flowers of muskmelon and its application. Background technique [0002] Melon Cucumis melo L. belongs to Cucurbitaceae Cucurbitaceae, and cucumber belongs to Cucumis. According to the data of the Food and Agriculture Organization of the United Nations (FAO), my country's melon production and cultivation area both rank first in the world, which is of great significance to improving the economic benefits of farmers. The flower type of melon can be divided into two types according to the planting part of the flower organ, namely unisexual female flower and bisexual flower. The currently cultivated melons are male and hermaphroditic flowers. In the process of the first generation of hybrid seed production, manual detasseling is required for pollination, and the operation is relatively complicated. If the detasseling operati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895
Inventor 刘莉张乔玲华德平付金玉
Owner TIANJIN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More