Unlock instant, AI-driven research and patent intelligence for your innovation.

Functional marker for wheat phytoene synthase gene psy-e2 and application thereof

A technology of psy-e2 and phytoene, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of accelerated breeding process, complex genome, and low efficiency of genetic improvement, and achieve The effect of improving efficiency and speeding up the breeding process

Active Publication Date: 2018-07-13
SHANDONG AGRICULTURAL UNIVERSITY
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Wheat is an allohexaploid with a complex genome. The efficiency of genetic improvement of agronomic traits simply by relying on traditional methods is low and cannot meet the current breeding needs. The use of functional gene markers for assisted selection can improve the efficiency of wheat breeding and accelerate the breeding process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Functional marker for wheat phytoene synthase gene psy-e2 and application thereof
  • Functional marker for wheat phytoene synthase gene psy-e2 and application thereof
  • Functional marker for wheat phytoene synthase gene psy-e2 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Production psy-e2 Functional Marker Primers

[0026] According to the wheat genome database psy Primers were designed for the conserved segment of the gene reference sequence, and the genomic DNA of the wheat sample with excellent resistance was extracted. After PCR amplification and sequencing analysis, the obtained psy-e2 Gene sequence from parent 7el 2 . The psy genes derived from the seventh homology group are 7A, 7B, 7D and psy-e2 Sequence (SEQ ID NO.3-6) alignment, design identification psy-e2 Gene-specific primers ( figure 1 ).

Embodiment 2

[0027] Example 2 Wheat phytoene synthase gene of the present invention psy-e2 feature flags.

[0028] Wheat phytoene synthase gene of the present invention psy-e2 Functional markers, where primers include:

[0029] Primer sequence PSY-F: TGGCTTCAATAGGATCAAAGTA (SEQ ID NO.1);

[0030] Primer sequence PSY-R: CCAGCTCGTCTGTCCTCCTG (SEQ ID NO. 2).

[0031] A kind of based on the present invention psy-e2 The method for identifying the wheat yellow pigment genotype of genes comprises the following steps:

[0032] (1) Buffer S method was used to extract the genomic DNA of the sample;

[0033] Described adopt Buffer S method to extract the DNA of wheat sample, concrete steps are as follows:

[0034] Weigh 0.05-0.10g of wheat leaves, freeze the leaves with liquid nitrogen and quickly grind them into powder, put them into a 1.5mL centrifuge tube, add 500μL of Buffer S extraction buffer preheated at 60°C, and the Buffer S extraction buffer is Liter contains 100mmol / L Tris-HCl (p...

Embodiment 3

[0040] Embodiment 3 Wheat phytoene synthase gene of the present invention psy-e2 Application of feature flags

[0041] Wheat phytoene synthase gene as described in Example 2 psy-e2 Functionally marked method to operate.

[0042] The sample population is parental SDAU2003 and Chinese spring ph1b Constructed F 4 Progeny samples.

[0043] A kind of wheat based on the present invention psy-e2 The method for identifying the wheat yellow pigment genotype of genes comprises the following steps:

[0044] (1) Collect samples;

[0045] (2) Buffer S method was used to extract the genomic DNA of the sample;

[0046] (3) Use the extracted DNA as a template for PCR amplification;

[0047] (4) The PCR product was detected on a non-denaturing 8% PAGE gel, and the color was developed after silver staining.

[0048] Analysis of electrophoresis results, primers PSY-F and PSY-R amplified three bands of 157bp, 183bp and 186bp, indicating that the wheat sample contained psy-e2 Gene; ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a functional marker for wheat phytoene synthase gene psy-e2, wherein PCR (Polymerase Chain Reaction) primer sequences are PSY-F and PSY-R. The assay steps are as follows: a Buffer S method is adopted to extract the whole genome DNA of wheat leaves; the psy-e2 gene functional marker is utilized to assay the extracted DNA to carry out PCR amplification; a PCR product undergoes PAGE (polyacrylamide gel electrophoresis), and after a silver staining method is adopted to carry out chromogenic reaction, a result is observed. The functional molecular marker for psy-e2 in the invention does not depend on molecular genetic mapping, and the functional marker can be utilized to increase the efficiency of molecular marker-assisted selection, and can also be directly applied in production practice, providing a technical support for the breeding of improved lines or hybrids with low flavin content by the molecular marker-assisted selection method.

Description

technical field [0001] The invention belongs to the technical field of wheat molecular breeding, and in particular relates to a functional marker for identifying phytoene synthase gene psy-e2 and a method thereof. Background technique [0002] Wheat is one of the most important food crops in the world. In recent years, with the improvement of living standards, people's demand for high-quality wheat is increasing, and more and more attention has been paid to the nutrition of flour and its products. How to make steamed buns, dumplings, noodles and other traditional steamed foods both delicious and good-looking and nutritious has become one of the goals of high-quality wheat breeding. The content of yellow pigment in wheat grains is closely related to the color and nutritional quality of cooked noodles. Bright white flour products are popular in China, Europe and the United States. Yellow pigment is an important factor that causes the whiteness of flour to decrease, and redu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/6895
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 孔令让王彪李学峰
Owner SHANDONG AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More