Functional marker for wheat phytoene synthase gene psy-e2 and application thereof
A technology of psy-e2 and phytoene, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of accelerated breeding process, complex genome, and low efficiency of genetic improvement, and achieve The effect of improving efficiency and speeding up the breeding process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Production psy-e2 Functional Marker Primers
[0026] According to the wheat genome database psy Primers were designed for the conserved segment of the gene reference sequence, and the genomic DNA of the wheat sample with excellent resistance was extracted. After PCR amplification and sequencing analysis, the obtained psy-e2 Gene sequence from parent 7el 2 . The psy genes derived from the seventh homology group are 7A, 7B, 7D and psy-e2 Sequence (SEQ ID NO.3-6) alignment, design identification psy-e2 Gene-specific primers ( figure 1 ).
Embodiment 2
[0027] Example 2 Wheat phytoene synthase gene of the present invention psy-e2 feature flags.
[0028] Wheat phytoene synthase gene of the present invention psy-e2 Functional markers, where primers include:
[0029] Primer sequence PSY-F: TGGCTTCAATAGGATCAAAGTA (SEQ ID NO.1);
[0030] Primer sequence PSY-R: CCAGCTCGTCTGTCCTCCTG (SEQ ID NO. 2).
[0031] A kind of based on the present invention psy-e2 The method for identifying the wheat yellow pigment genotype of genes comprises the following steps:
[0032] (1) Buffer S method was used to extract the genomic DNA of the sample;
[0033] Described adopt Buffer S method to extract the DNA of wheat sample, concrete steps are as follows:
[0034] Weigh 0.05-0.10g of wheat leaves, freeze the leaves with liquid nitrogen and quickly grind them into powder, put them into a 1.5mL centrifuge tube, add 500μL of Buffer S extraction buffer preheated at 60°C, and the Buffer S extraction buffer is Liter contains 100mmol / L Tris-HCl (p...
Embodiment 3
[0040] Embodiment 3 Wheat phytoene synthase gene of the present invention psy-e2 Application of feature flags
[0041] Wheat phytoene synthase gene as described in Example 2 psy-e2 Functionally marked method to operate.
[0042] The sample population is parental SDAU2003 and Chinese spring ph1b Constructed F 4 Progeny samples.
[0043] A kind of wheat based on the present invention psy-e2 The method for identifying the wheat yellow pigment genotype of genes comprises the following steps:
[0044] (1) Collect samples;
[0045] (2) Buffer S method was used to extract the genomic DNA of the sample;
[0046] (3) Use the extracted DNA as a template for PCR amplification;
[0047] (4) The PCR product was detected on a non-denaturing 8% PAGE gel, and the color was developed after silver staining.
[0048] Analysis of electrophoresis results, primers PSY-F and PSY-R amplified three bands of 157bp, 183bp and 186bp, indicating that the wheat sample contained psy-e2 Gene; ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



