Application of heat shock protein groEL to preparation of reagent for detecting Helicobacter pylori
A technology of heat shock protein and Helicobacter pylori, which is applied in the application field of reagents, can solve problems such as incompleteness, and achieve the effect of increased detection rate and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] The preparation of embodiment 1 recombinant groEL protein
[0037] 1. Acquisition of groEL target gene:
[0038] 1. Design of groEL primers:
[0039] groEL-F: cgcgctcgagggcaaaagaaatcaaat
[0040] groEL-R:tctggtacccatcatgccacccatggc
[0041] 2. Using the strain NCTC 11637 as a template to amplify the groEL target gene:
[0042] The PCR reaction system is as follows:
[0043]
[0044]
[0045] PCR reaction parameters:
[0046]
[0047] The PCR electrophoresis product picture is as follows figure 1 .
[0048] Analysis of the results: a single band was amplified from the groEL target gene, the size of which was between 1500bp and 2000bp, which was in line with the size of the target gene groEL 1638bp.
[0049] 2. Double digestion, ligation and transformation of target gene groEL and vector pTrchis2C
[0050] 1. Double digestion of target gene groEL and vector pTrchis2C
[0051] Use XhoI and KpnI to double-digest the plasmid vector pTrchis2C and the target ...
Embodiment 2
[0067] The preparation of embodiment 2 enzyme plate
[0068] 1. Dilute the recombinant groEL protein to 1 μg / ml as a coating solution, 100 μL / well, put it in an aluminum foil bag at 4°C overnight for coating (37°C for 2 hours has the same effect).
[0069] 2. Shake off the coating solution and pat dry.
[0070] 3. Wash three times with washing solution, soak for 1min each time, 300μL / well, shake off the washing solution, and pat dry.
[0071] 4. Blocking: block with 200 μl / well of blocking solution, block at 37°C for 1 hour, shake off the blocking solution, pat dry, and wash three times with the same method as above.
[0072] 5. Dry at 37°C for 1-2 hours.
[0073] 6. Put the dried ELISA plate and desiccant into an aluminum foil bag and seal it at 4°C for later use.
Embodiment 3E
[0074] Embodiment 3ELISA detects Helicobacter pylori
[0075] 1. Samples to be tested:
[0076] Sample 1: Dilute the negative serum confirmed to contain no groEL antibody 100 times with the sample diluent, and add Escherichia coli, denatured bacteria, Campylobacter jejuni, Bacillus subtilis, Enterococcus faecium, and Pseudomonas albicans to the diluted negative serum. silk yeast.
[0077] Sample 2: The 8 strong positive sera confirmed to contain groEL antibodies were diluted 100 times with the sample diluent, and the diluted strong positive sera were added with Helicobacter pylori standard strain 11637, Escherichia coli, denatured bacteria, Campylobacter jejuni, Bacillus subtilis, Enterococcus faecium, Candida albicans.
[0078] Measure the OD of the cultured bacterial solution 600 , use 1ml 100-fold diluted serum to make the OD of the bacterial solution 600 When adjusted to 0.2 (OD600=0.1, the CFU per milliliter of bacterial solution is 1*10 7 ), the calculation method i...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com