A kind of engineering bacteria and its application in the preparation of (r)-3-hydroxyl-5-hexenoate
A technology of hexenoate and engineering bacteria is applied in the application field of engineering bacteria to prepare -3-hydroxy-5-hexenoate, which can solve the problems of cumbersome production operations, increase industrial production costs and the like, and achieve simple and convenient operation. , the effect of low cost and excellent practical industrial application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Embodiment 1, the preparation of recombinant plasmid pET-duet-KRED (1)
[0031] Using the recombinant plasmid pET-24b-KRED previously reported (Chinese patent application CN107119081A) as a template, the ketoreductase (KRED) gene was cloned with primers F_KRED / R_KRED to obtain a 759bp KRED gene (SEQ ID NO.1).
[0032] The sequence of primer F_KRED is:
[0033] 5'-TTTAACTTTAAGAAGGAGATATACCATGACCGACCGTCTGAAAGGTAAAG (SEQ ID NO.3)
[0034] The sequence of primer R_KRED is:
[0035] 5'-CTGCAGGCGCGCCGAGCTCGAATTCTCACTGCGCGGTCCAGCCGCCAT (SEQ ID NO.4)
[0036] The gene fragment containing the ketoreductase gene was recombined with the double digestion product (NcoI and EcoRI) of the pET-duet plasmid, and transformed into the cloning host E.coli DH5. Use primers F_KRED / R_KRED for colony PCR verification, transform recombinants, extract recombinant plasmids, and perform sequencing. The recombinant plasmid with correct sequencing results is the recombinant plasmid pET-duet-KRED...
Embodiment 2
[0037] Embodiment 2, preparation of recombinant plasmid pRSF-duet-IPD (1)
[0038] Using the recombinant plasmid pET-22b-IPD previously reported (Chinese patent application CN107119081A) as a template, the isopropanol dehydrogenase (IPD) gene was cloned with primers F_IPD / R_IPD to obtain a 759bp IPD gene (SEQ ID NO.2) . The sequence of primer F_IPD is:
[0039] 5'-TTTAACTTTAATAAGGAGATATACCATGACTGATCGTTTAAAAGGCAAAGT (SEQ ID NO.5)
[0040] The sequence of primer R_IPD is:
[0041] 5'-CTGCAGGCGCGCCGAGCTCGAATTCTTATTGAGCAGTGTATCCACCAT (SEQ ID NO. 6)
[0042] The gene fragment containing the isopropanol dehydrogenase gene was recombined with the double digestion product (NcoI and EcoRI) of the pRSF-duet plasmid, and transformed into the cloning host E.coli DH5. Use primers F_IPD / R_IPD for colony PCR verification, transform recombinants, extract recombinant plasmids, and perform sequencing. The recombinant plasmid with correct sequencing results is the recombinant plasmid pRSF-d...
Embodiment 3
[0043] Embodiment 3, construction and induced expression of genetically engineered bacteria
[0044] Use the plasmids pET-duet-KRED(1) and pRSF-duet-IPD(1) constructed in Examples 1 and 2 to co-transform the expression host E.coli JM109(DE3), screen to obtain positive clones, and name the engineered bacteria For Eco-KRED-IPD.
[0045]The engineered bacteria were inoculated into 5 mL liquid LB medium containing kanamycin and ampicillin for activation for 8 hours (37° C., 180 rpm). The above-mentioned activated culture was transferred to 50 mL liquid LB medium containing kanamycin and ampicillin at an inoculum size of 1 / 100 and cultured overnight (37° C., 180 rpm). Take the overnight culture and transfer it to 5L liquid medium containing kanamycin (50mg) and ampicillin (50mg) with an inoculum size of 1 / 100 (placed in a 7L fermenter, containing 2% tryptone, 1% yeast powder, 1% NaCl) fermentation culture (30°C, 300rpm) to OD 600 When it reached 10, IPTG (70 mg) was added, and c...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


