A kind of engineering bacteria and its application in the preparation of (r)-3-hydroxyl-5-hexenoate

A technology of hexenoate and engineering bacteria is applied in the application field of engineering bacteria to prepare -3-hydroxy-5-hexenoate, which can solve the problems of cumbersome production operations, increase industrial production costs and the like, and achieve simple and convenient operation. , the effect of low cost and excellent practical industrial application value

Active Publication Date: 2021-10-26
FUDAN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in this report, the ketoreductase used to catalyze the reaction and the isopropanol dehydrogenase used to regenerate the coenzyme need to be prepared by separate fermentation, which makes the production operation cumbersome and increases the cost of industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of engineering bacteria and its application in the preparation of (r)-3-hydroxyl-5-hexenoate
  • A kind of engineering bacteria and its application in the preparation of (r)-3-hydroxyl-5-hexenoate
  • A kind of engineering bacteria and its application in the preparation of (r)-3-hydroxyl-5-hexenoate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1, the preparation of recombinant plasmid pET-duet-KRED (1)

[0031] Using the recombinant plasmid pET-24b-KRED previously reported (Chinese patent application CN107119081A) as a template, the ketoreductase (KRED) gene was cloned with primers F_KRED / R_KRED to obtain a 759bp KRED gene (SEQ ID NO.1).

[0032] The sequence of primer F_KRED is:

[0033] 5'-TTTAACTTTAAGAAGGAGATATACCATGACCGACCGTCTGAAAGGTAAAG (SEQ ID NO.3)

[0034] The sequence of primer R_KRED is:

[0035] 5'-CTGCAGGCGCGCCGAGCTCGAATTCTCACTGCGCGGTCCAGCCGCCAT (SEQ ID NO.4)

[0036] The gene fragment containing the ketoreductase gene was recombined with the double digestion product (NcoI and EcoRI) of the pET-duet plasmid, and transformed into the cloning host E.coli DH5. Use primers F_KRED / R_KRED for colony PCR verification, transform recombinants, extract recombinant plasmids, and perform sequencing. The recombinant plasmid with correct sequencing results is the recombinant plasmid pET-duet-KRED...

Embodiment 2

[0037] Embodiment 2, preparation of recombinant plasmid pRSF-duet-IPD (1)

[0038] Using the recombinant plasmid pET-22b-IPD previously reported (Chinese patent application CN107119081A) as a template, the isopropanol dehydrogenase (IPD) gene was cloned with primers F_IPD / R_IPD to obtain a 759bp IPD gene (SEQ ID NO.2) . The sequence of primer F_IPD is:

[0039] 5'-TTTAACTTTAATAAGGAGATATACCATGACTGATCGTTTAAAAGGCAAAGT (SEQ ID NO.5)

[0040] The sequence of primer R_IPD is:

[0041] 5'-CTGCAGGCGCGCCGAGCTCGAATTCTTATTGAGCAGTGTATCCACCAT (SEQ ID NO. 6)

[0042] The gene fragment containing the isopropanol dehydrogenase gene was recombined with the double digestion product (NcoI and EcoRI) of the pRSF-duet plasmid, and transformed into the cloning host E.coli DH5. Use primers F_IPD / R_IPD for colony PCR verification, transform recombinants, extract recombinant plasmids, and perform sequencing. The recombinant plasmid with correct sequencing results is the recombinant plasmid pRSF-d...

Embodiment 3

[0043] Embodiment 3, construction and induced expression of genetically engineered bacteria

[0044] Use the plasmids pET-duet-KRED(1) and pRSF-duet-IPD(1) constructed in Examples 1 and 2 to co-transform the expression host E.coli JM109(DE3), screen to obtain positive clones, and name the engineered bacteria For Eco-KRED-IPD.

[0045]The engineered bacteria were inoculated into 5 mL liquid LB medium containing kanamycin and ampicillin for activation for 8 hours (37° C., 180 rpm). The above-mentioned activated culture was transferred to 50 mL liquid LB medium containing kanamycin and ampicillin at an inoculum size of 1 / 100 and cultured overnight (37° C., 180 rpm). Take the overnight culture and transfer it to 5L liquid medium containing kanamycin (50mg) and ampicillin (50mg) with an inoculum size of 1 / 100 (placed in a 7L fermenter, containing 2% tryptone, 1% yeast powder, 1% NaCl) fermentation culture (30°C, 300rpm) to OD 600 When it reached 10, IPTG (70 mg) was added, and c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biopharmaceuticals, and specifically discloses an engineering bacterium and its preparation ( R )-3-hydroxy-5-hexenoate (I). The engineering bacterium of the present invention includes a host cell and two target genes co-transformed into the host cell, which are respectively the ketoreductase gene shown in SEQ ID NO.1 and the isopropyl gene shown in SEQ ID NO.2. Alcohol dehydrogenase gene. In the present invention, the ketoreductase gene shown in SEQ ID NO.1 and the isopropanol dehydrogenase gene shown in SEQ ID NO.2 are jointly introduced into the host cell to construct engineering bacteria that can express ketoreductase KRED and isopropanol dehydrogenase Hydrogenase IPD, through the catalysis of KRED and the recycling of IPD to the coenzyme NADPH, realizes the efficient and high stereoselective reduction of 3-carbonyl-5-hexenoic acid ester (II) ( R )‑3‑hydroxy‑5‑hexenoate (I).

Description

technical field [0001] The invention belongs to the technical field of biopharmaceuticals, and in particular relates to engineering bacteria and its application in preparing (R)-3-hydroxy-5-hexenoate. Background technique [0002] (R)-3-Hydroxy-5-hexenoate is an important chiral compound that is widely used in the synthesis of pharmaceutical and chemical intermediates including statins and blood lipid-lowering drugs. Its structural formula is as follows, where R is C 1 -C 8 Alkyl or cycloalkyl, mono- or polysubstituted aryl or aralkyl. [0003] [0004] As the main way to synthesize compound (I) and its structural analogues at present, chemical methods have their shortcomings, such as often need to use extreme reaction conditions, including -20 ° C to -50 ° C low temperature (US Patent US6355822) and high hydrogen Pressure (European patent EP1176135) etc. These harsh reaction conditions severely limit the industrial prospects of chemical preparation of such compounds. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12P7/62C12R1/19
CPCC12N9/0006C12P7/62C12Y101/0108C12Y101/01184
Inventor陈芬儿黄则度孟歌梁小明王建
OwnerFUDAN UNIV