Mulberry-derived enterobacter cloacae specific sequence, primer group Yt4 as well as applications of specific sequence and primer group Yt4 in detection of enterobacter cloacae

A technology of Enterobacter cloacae and specific sequence, applied in the directions of microorganism-based methods, biochemical equipment and methods, and microbial determination/inspection, etc., can solve the difficulty, low sensitivity and low efficiency of the detection and identification of mulberry wilt. and other problems, to achieve the effect of reliable detection results, high sensitivity and convenient use.

Active Publication Date: 2018-08-24
SOUTH CHINA AGRI UNIV
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, the late symptoms of mulberry wilt are similar to the symptoms of mulberry bacterial wilt, which further increases the difficulty of detection and identification of mulberry wilt
[0004] At present, the detection technology of mulberry wilt mainly adopts traditional separation technology and PCR technology, which takes a long time, has low efficiency and low sensitivity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mulberry-derived enterobacter cloacae specific sequence, primer group Yt4 as well as applications of specific sequence and primer group Yt4 in detection of enterobacter cloacae
  • Mulberry-derived enterobacter cloacae specific sequence, primer group Yt4 as well as applications of specific sequence and primer group Yt4 in detection of enterobacter cloacae
  • Mulberry-derived enterobacter cloacae specific sequence, primer group Yt4 as well as applications of specific sequence and primer group Yt4 in detection of enterobacter cloacae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1 Obtaining the specific gene sequence of Enterobacter cloacae

[0064] Using the high-throughput whole-genome sequencing method, the whole genome sequence of Enterobacter cloacae was assembled, and a total of 4.73Mb whole genome sequence was assembled. The number of G bases was 1039163 bp, accounting for 28.04%; the number of C bases was 1325068 bp, accounting for The ratio is 28.01%, and the ratio of GC is 56.05%, encoding 4600 genes; the number of A bases is 1039163 bp, accounting for 21.95%; the number of T bases is 1325068 bp, accounting for 28%. Enterobacter cloacae was found in the soil of the branches and roots of diseased mulberries. The Enterobacter cloacae from the mulberry source was significantly different from other Enterobacter cloacae, and the similarity to the strain with the highest similarity (AP018340.1) was 97%. through

[0065] Based on the comparative analysis of the whole genome of Enterobacter cloacae, the specific gene sequence was obtained...

Embodiment 2

[0066] Example 2 Construction and sequencing analysis of specific gene cloning plasmid based on Enterobacter mulberry

[0067] The DNA of Enterobacter cloacae was used as the PCR amplification template, and the primer 5f / 2007r (5f: ggtgtctggacaatctcagt; 2007r: catttcaaccagttacgata) was used for PCR amplification.

[0068] After PCR amplification products are detected by agarose gel electrophoresis, the specific target fragments are recovered under ultraviolet light, and the target fragments are recovered according to the steps of the DNA rapid recovery / purification kit (purchased from Beijing Dingguo Biotechnology Co., Ltd.).

[0069] Vector connection: The purpose of recovery is to connect with pEASY@-Blunt vector (system: PCR product 1 µL, pEASY@-Blunt vector 1 µL, dH2O 3 µL), mix well and ligate at 25°C for 15 min.

[0070] Transformation of the ligation product: add the ligation product and 50 µL of newly thawed Trans1-T1 competent cells, mix gently, ice bath for 25 minutes, activa...

Embodiment 3

[0073] Example 3 Design of primers for detection of Enterobacter cloacae and establishment of LAMP amplification method

[0074] 1. Primer design and screening

[0075] Based on the specific gene of Enterobacter cloacae obtained in Example 1 (shown in SEQ ID NO.1), a large number of primers were designed, and after analysis and screening, a set of primer sets with excellent specificity and sensitivity were finally obtained , Named Yt4. The sequence of the primer set is shown in Table 1 below:

[0076] Table 1 The sequence of primer set Yt4

[0077]

[0078] 2. Establishment of LAMP amplification method

[0079] (1) Optimization of LAMP amplification reaction temperature

[0080] Using 5 ng / μL of Enterobacter cloacae DNA as template, and Yt4 primer set as amplification primers, at 60℃, 61℃, 62℃, 63℃, 64℃, 65℃ and other 6 different reaction temperatures Perform LAMP amplification with 25μL amplification system (as shown in Table 3).

[0081] (2) Optimization of the concentration ratio of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a section of a mulberry-derived enterobacter cloacae specific sequence, a primer group Yt4 as well as applications of the specific sequence and the primer group Yt4 in molecular detection of enterobacter cloacae. The specific sequence is shown in SEQ ID NO.1; the primer group Yt4 comprises primers Yt4-FIP, Yt4-BIP, Yt4-F3 and Yt4-B3; nucleotide sequences of the primer groupYt4 are sequentially shown in SEQ ID NO.2-5. Specific detection of the enterobacter cloacae, particularly quick distinguishing of other mulberry diseases, can be realized on the basis of the specificsequence, and the specific sequence has important technical support value and application prospects in actual detection application of the enterobacter cloacae. The primer group Yt4, a construction method and a kit are convenient to use and applicable to very diversified amplification templates, have reliable detection results, high specificity, high sensitivity and visualization, have good effects in early detection and quick detection of blight caused by enterobacter cloacae and have good actual popularization and application prospects in monitoring, preventing and controlling mulberry blight.

Description

Technical field [0001] The invention belongs to the technical field of pathogen detection. More specifically, it relates to a specific sequence of Enterobacter cloacae from mulberry source and primer set Yt4 and its application in molecular detection of Enterobacter cloacae. Background technique [0002] Enterobacter cloacae ( Enterobacter cloacae ) Is one of the most discovered plant pathogens in the genus Enterobacter. It is a conditional pathogen that causes the host to become sick under the conditions of high temperature and humidity. For example, Enterobacter cloacae causes wet heart disease of elm trees (1945), coconut wilt disease (1976), papaya fruit yellowing disease (1987) onion rot disease (1990), etc.; in addition, in Chinese mulberry trees, Enterobacter cloacae flora It is the pathogenic bacteria of Enterobacter mulberry wilt, also known as mulberry wilt (Wang et al, 2010). It is an important disease of mulberry trees. In recent years, it has occurred in mulberry or...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/10C12N15/11C12R1/01
CPCC12Q1/6844C12Q1/689C12Q2531/119
Inventor刘吉平杨宏宇孙勋勋
OwnerSOUTH CHINA AGRI UNIV