Specific sequence and primer set yt4 of Enterobacter cloacae from Mulberry origin and its application in detection of Enterobacter cloacae
A technology of Enterobacter cloacae and primer set, which is applied in the directions of microorganism-based methods, biochemical equipment and methods, and microbial determination/inspection, etc., can solve the difficulty of increasing the detection and identification of mulberry wilt, with low sensitivity and long time consuming. and other problems, to achieve the effect of reliable detection results, high sensitivity, and increased range
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Example 1 Acquisition of Specific Gene Sequences of Enterobacter cloacae from Mulberry Origin
[0064] Using the method of high-throughput whole-genome sequencing, a total of 4.73Mb whole-genome sequence of Enterobacter cloacae was assembled, the number of G bases was 1,039,163 bp, accounting for 28.04%; the number of C bases was 1,325,068 bp, accounting for 28.04%. The proportion of GC is 28.01%, and the proportion of GC is 56.05%, encoding 4600 genes; the number of A bases is 1039163 bp, accounting for 21.95%; the number of T bases is 1325068 bp, accounting for 28%. Enterobacter cloacae was found in the branches and root soil of the diseased mulberry. The mulberry-derived Enterobacter cloacae was significantly different from other Enterobacter cloacae, and the similarity with the strain with the highest similarity (AP018340.1) was 97%. through
[0065] Based on the comparative analysis of the entire genome of Enterobacter mulberry cloacae, its specific gene sequence ...
Embodiment 2
[0066] Example 2 Construction and sequencing analysis of a specific gene cloning plasmid based on Enterobacter mulberry cloacae
[0067] The DNA of Enterobacter mulberry cloacae was used as PCR amplification template, and the primer 5f / 2007r (5f:ggtgtctggacaatctcagt; 2007r:catttcaaccagttacgata) was used for PCR amplification.
[0068] After the PCR amplification products were detected by agar gel electrophoresis, the specific fragments of interest were recovered under ultraviolet light, and the target fragments were recovered according to the steps of the DNA Rapid Recovery / Purification Kit (purchased from Beijing Dingguo Biotechnology Co., Ltd.).
[0069] Carrier connection: The recovered object was connected with the pEASY@-Blunt carrier (system: 1 µL of PCR recovered product, 1 µL of pEASY@-Blunt carrier, 3 µL of dH2O) and then ligated at 25°C for 15 min.
[0070] Transformation of the ligation product: add the ligation product to 50 µL of freshly thawed Trans1-T1 competent...
Embodiment 3
[0073] Example 3 Design of primers for detection of Enterobacter cloacae and establishment of LAMP amplification method
[0074] 1. Primer design and screening
[0075] Based on the specific gene of Enterobacter cloacae obtained in Example 1 (shown in the sequence SEQ ID NO.1), a large number of primers were designed, and after analysis and screening, a set of primers with excellent specificity and sensitivity was finally obtained , named Yt4. The sequence of the primer set is shown in Table 1 below:
[0076] Table 1 The sequence of primer set Yt4
[0077]
[0078] 2. Establishment of LAMP amplification method
[0079] (1) LAMP amplification reaction temperature optimization
[0080] Using 5 ng / μL of Enterobacter cloacae DNA as a template, and using Yt4 primer set as amplification primers respectively, at 6 different reaction temperatures of 60°C, 61°C, 62°C, 63°C, 64°C, and 65°C LAMP amplification was performed under the following conditions, and the amplification sys...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com