Specific sequence and primer set yt4 of Enterobacter cloacae from Mulberry origin and its application in detection of Enterobacter cloacae

A technology of Enterobacter cloacae and primer set, which is applied in the directions of microorganism-based methods, biochemical equipment and methods, and microbial determination/inspection, etc., can solve the difficulty of increasing the detection and identification of mulberry wilt, with low sensitivity and long time consuming. and other problems, to achieve the effect of reliable detection results, high sensitivity, and increased range

Active Publication Date: 2021-10-29
SOUTH CHINA AGRI UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, the late symptoms of mulberry wilt are similar to the symptoms of mulberry bacterial wilt, which further increases the difficulty of detection and identification of mulberry wilt
[0004] At present, the detection technology of mulberry wilt mainly adopts traditional separation technology and PCR technology, which takes a long time, has low efficiency and low sensitivity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific sequence and primer set yt4 of Enterobacter cloacae from Mulberry origin and its application in detection of Enterobacter cloacae
  • Specific sequence and primer set yt4 of Enterobacter cloacae from Mulberry origin and its application in detection of Enterobacter cloacae
  • Specific sequence and primer set yt4 of Enterobacter cloacae from Mulberry origin and its application in detection of Enterobacter cloacae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1 Acquisition of Specific Gene Sequences of Enterobacter cloacae from Mulberry Origin

[0064] Using the method of high-throughput whole-genome sequencing, a total of 4.73Mb whole-genome sequence of Enterobacter cloacae was assembled, the number of G bases was 1,039,163 bp, accounting for 28.04%; the number of C bases was 1,325,068 bp, accounting for 28.04%. The proportion of GC is 28.01%, and the proportion of GC is 56.05%, encoding 4600 genes; the number of A bases is 1039163 bp, accounting for 21.95%; the number of T bases is 1325068 bp, accounting for 28%. Enterobacter cloacae was found in the branches and root soil of the diseased mulberry. The mulberry-derived Enterobacter cloacae was significantly different from other Enterobacter cloacae, and the similarity with the strain with the highest similarity (AP018340.1) was 97%. through

[0065] Based on the comparative analysis of the entire genome of Enterobacter mulberry cloacae, its specific gene sequence ...

Embodiment 2

[0066] Example 2 Construction and sequencing analysis of a specific gene cloning plasmid based on Enterobacter mulberry cloacae

[0067] The DNA of Enterobacter mulberry cloacae was used as PCR amplification template, and the primer 5f / 2007r (5f:ggtgtctggacaatctcagt; 2007r:catttcaaccagttacgata) was used for PCR amplification.

[0068] After the PCR amplification products were detected by agar gel electrophoresis, the specific fragments of interest were recovered under ultraviolet light, and the target fragments were recovered according to the steps of the DNA Rapid Recovery / Purification Kit (purchased from Beijing Dingguo Biotechnology Co., Ltd.).

[0069] Carrier connection: The recovered object was connected with the pEASY@-Blunt carrier (system: 1 µL of PCR recovered product, 1 µL of pEASY@-Blunt carrier, 3 µL of dH2O) and then ligated at 25°C for 15 min.

[0070] Transformation of the ligation product: add the ligation product to 50 µL of freshly thawed Trans1-T1 competent...

Embodiment 3

[0073] Example 3 Design of primers for detection of Enterobacter cloacae and establishment of LAMP amplification method

[0074] 1. Primer design and screening

[0075] Based on the specific gene of Enterobacter cloacae obtained in Example 1 (shown in the sequence SEQ ID NO.1), a large number of primers were designed, and after analysis and screening, a set of primers with excellent specificity and sensitivity was finally obtained , named Yt4. The sequence of the primer set is shown in Table 1 below:

[0076] Table 1 The sequence of primer set Yt4

[0077]

[0078] 2. Establishment of LAMP amplification method

[0079] (1) LAMP amplification reaction temperature optimization

[0080] Using 5 ng / μL of Enterobacter cloacae DNA as a template, and using Yt4 primer set as amplification primers respectively, at 6 different reaction temperatures of 60°C, 61°C, 62°C, 63°C, 64°C, and 65°C LAMP amplification was performed under the following conditions, and the amplification sys...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific sequence of a mulberry-derived Enterobacter cloacae, a primer set Yt4 and its application in molecular detection of Enterobacter cloacae. The specific sequence is shown in SEQ ID NO.1, and the primer set Yt4 includes primers Yt4-FIP, Yt4-BIP, Yt4-F3, Yt4-B3, and its nucleotide sequence is shown in SEQ ID NO.2~5 in sequence . Based on the specific sequence, Enterobacter cloacae can be specifically detected, especially other mulberry diseases can be quickly distinguished, which has important technical support value and application prospect in the actual detection application of Enterobacter cloacae. The primer set Yt4 and the constructed method and kit are easy to use, applicable to a wide variety of amplification templates, reliable detection results, strong specificity, high sensitivity, and visualization, and can be used in the early detection and rapid detection of Enterobacter cloacae wilt The invention has a good effect, and has a good prospect of practical popularization and application in the monitoring, prevention and control of mulberry wilt disease.

Description

technical field [0001] The invention belongs to the technical field of pathogenic organism detection. More specifically, it relates to a specific sequence of Enterobacter cloacae from mulberry source, a primer set Yt4 and its application in the molecular detection of Enterobacter cloacae. Background technique [0002] Enterobacter cloacae ( Enterobacter cloacae ) is the most widely studied plant pathogen in the Enterobacter genus. For example, Enterobacter cloacae causes elm wet heart disease (1945), coconut wilt disease (1976), papaya yellowing disease (1987), onion rot disease (1990), etc.; It is the pathogenic bacteria of Enterobacter mulberry wilt, also known as mulberry wilt (Wang et al, 2010). It is an important disease of mulberry trees. Serious losses have been caused to sericulture production. [0003] Due to the variety of host species and complex sources of Enterobacter cloacae, the detection and identification of mulberry wilt has always been the focus and di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/10C12N15/11C12R1/01
CPCC12Q1/6844C12Q1/689C12Q2531/119
Inventor刘吉平杨宏宇孙勋勋
OwnerSOUTH CHINA AGRI UNIV