Preparation method and application of a CD132 gene-deleted immunodeficiency animal model

A technology of immunodeficiency and animal models, applied in the field of animal genetic engineering, can solve the problems of affecting experimental results, impure background, long cycle, etc.

Active Publication Date: 2020-03-13
BIOCYTOGEN JIANGSU CO LTD +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The use of genetic mating and multi-generation backcross purification methods to construct immunodeficiency mouse strains has a long cycle (it needs to be backcrossed with NOD-SCID mice for at least 10 generations, at least 2 years), and the background is impure (multi-background mouse hybridization, backcross), poor reproducibility of experimental results, etc.
It has been shown in the literature that the phenotype of knockout mice is dependent on the genetic background (Laboratory AnimalScience.1999Apr; 49(2):137-43.), while the IL-2Rγ gene mutation used in the preparation process of NOG mice The CD132 gene in the mouse is not completely deleted, and it may still be combined with a variety of cytokines to affect the experimental results (Nat RevImmunol.2007Feb; 7(2):118-30.; Blood.2010Jul 15; 116(2):193- 200)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of a CD132 gene-deleted immunodeficiency animal model
  • Preparation method and application of a CD132 gene-deleted immunodeficiency animal model
  • Preparation method and application of a CD132 gene-deleted immunodeficiency animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0168] Example 1 Design of CD132 gene sgRNA

[0169] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0170] Multiple sgRNAs are designed for mouse immune-related genes, where the target site sequence targeted by each sgRNA is as follows:

[0171] sgRNA-1 target site sequence (SEQ ID NO: 1): 5'-ccaccggaagctacgacaaaagg-3'

[0172] sgRNA-2 target site sequence (SEQ ID NO: 2): 5'-tctctacagcgtggtttctaagg-3'

[0173] sgRNA-3 target site sequence (SEQ ID NO: 3): 5'-ggcttgtgggagagtggttcagg-3'

[0174] sgRNA-4 target site sequence (SEQ ID NO: 4): 5'-ccacgctgtagagagagggggggg-3'

[0175] sgRNA-5 target site sequence (SEQ ID NO: 5): 5'-agggggaggttagcgtcacttagg-3'

[0176] sgRNA-6 target site sequence (SEQ ID NO: 6): 5'-gaaatcgaaacttagccccaagg-3'

[0177] sgRNA-7 t...

Embodiment 2

[0181] Example 2 Screening of CD132 gene sgRNA

[0182] UCA kit was used to detect the activities of multiple sgRNAs. The results showed that the sgRNAs had different activities. For the test results, see figure 1 . Among them, the activities of sgRNA-1 and sgRNA-7 are relatively low, which may be caused by the particularity of the target site sequence, but according to our experiments, the values ​​of L-1 and R-7 are still significantly higher than those of the control group, and can still be Judging that sgRNA-1 and sgRNA-7 are active, the activity meets the requirements of gene targeting experiments. According to the activity detection results, sgRNA3 (relative activity value of 16.1±1.2) and sgRNA6 (relative activity value of 21.7±1.5) were preferred for subsequent experiments. Remove the three NGG bases at the 3' end of the sgRNA sequence to obtain the upper and lower single strands as follows:

[0183] sgRNA3: upstream: 5'-ggcttgtgggagagtggttc-3' (SEQ ID NO: 18)

[0...

Embodiment 3

[0190] Example 3 pT7sgRNA-G2 plasmid construction

[0191] The fragmented DNA containing the T7 promoter and sgRNA scaffold was synthesized by a plasmid synthesis company and ligated to the backbone vector pHSG299 by restriction enzyme digestion (EcoRI and BamHI) in sequence. After sequencing verification by a professional sequencing company, the results showed that the target plasmid: pT7sgRNA-G2 plasmid was obtained , see the plasmid map of pT7sgRNA-G2 figure 2 .

[0192] Fragment DNA containing T7 promoter and sgRNA scaffold (SEQ ID NO: 13):

[0193] gaattctaatacgactcactataggggtcttcgagaagacctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttaaaggatcc

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method and application of an immunodeficiency animal model obtained by obtaining sgRNA capable of specifically targeting CD132 gene and CD132 gene deletion based on CRISPR / Cas9 technology. The invention also protects a CRISPR / Cas9 system for specifically targeting knockout of the CD132 gene, a method for preparing an sgRNA plasmid for obtaining an animal model of immunodeficiency, a method for preparing an animal model of immunodeficiency, and related applications. The invention provides a tool mouse suitable for human cell or tissue transplantation and a new method for preparing a humanized animal model, which is beneficial to the research of related diseases and provides an effective technical means for the development of biomedical experiments.

Description

technical field [0001] This application belongs to the field of animal genetic engineering and relates to CRISPR / Cas9 technology, in particular to a method for obtaining an animal model of immunodeficiency based on CRISPR / Cas9 gene knockout technology and an sgRNA for specifically targeting the CD132 gene. Background technique [0002] CRISPR / Cas9 is an emerging technology discovered in recent years that the RNA-guided Cas9 nuclease targets the target gene for editing. In the CRISPR / Cas9 system, crRNA (CRISPR-derived RNA) combines with tracrRNA (trans-activating RNA) to form a double-stranded RNA through the principle of DNA base pairing, and guides the Cas9 protein to cut the double-stranded RNA at the target site of the crRNA-guided DNA sequence. strand DNA. The CRISPR / Cas9 system can realize highly flexible and specific genome editing in eukaryotic cells. It is currently the most popular new-generation genome editing technology in the field of genome editing. At present,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/90C12N9/22C12N15/66C12N15/113A01K67/027C12N5/10C12N5/09A61K49/00
CPCA01K67/0275A01K2217/075A01K2227/105A01K2267/0325A61K49/0008C12N5/0693C12N9/22C12N15/113C12N15/66C12N15/907C12N2310/10C12N2510/00A01K67/0276A01K2207/12A01K2217/15A01K2267/0331C07K14/7155C12N15/1138C12N15/8509C12N2310/20A01K67/0271
Inventor沈月雷白阳张美玲姚佳维黄蕤郭雅南
OwnerBIOCYTOGEN JIANGSU CO LTD