Synthetic gene as well as method and application for establishing tobacco multi-gene site-directed mutation vector

A technology for gene synthesis and site-directed mutagenesis, applied in the field of genetic engineering, can solve problems such as time-consuming and labor-intensive, inability to obtain multiple mutants, and achieve the effects of simplifying intermediate steps, good application and promotion prospects, and ensuring mutation efficiency.

Inactive Publication Date: 2018-09-14
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method has the following problems: 1. The site of gene mutation is random, and single mutants at the desired gene site cannot be obtained; 2. Multiple mutants are obtained through hybridization and recombination. If there is a close linkage between several genes , it is almost impossible to obtain multiple mutants; 3. The whole process is time-consuming and labor-intensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Synthetic gene as well as method and application for establishing tobacco multi-gene site-directed mutation vector
  • Synthetic gene as well as method and application for establishing tobacco multi-gene site-directed mutation vector
  • Synthetic gene as well as method and application for establishing tobacco multi-gene site-directed mutation vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0102]Two sgRNA sequences were designed for Ntab1 and Ntab2 genes, sgRNA1: agcactaggagggaaaagaa; sgRNA2: gggatctcacagacaatgat. then follow figure 1 Target site gene sequences for synthetic mutations of these 2 genes are shown. By extracting the amplified pUC57-Kan Escherichia coli plasmid (the plasmid contains multiple gene knockout target site sequences), such as figure 2 As shown, after digestion with Bsa I, the DNA band marked by the white arrow shows the band of the synthetic gene. After cutting the gel to recover the synthetic gene, use T4 ligase to digest the pORE-CRISPR / Cas9 ( figure 2 The position marked by the black arrow) was ligated with the plant expression vector, and the ligated product was transformed into Escherichia coli, and after verification by screening and sequencing, a knockout multi-gene CRISPR / Cas9 vector was obtained. The constructed vector was transformed into tobacco, and the Ntab1 and Ntab2 genes were detected by sequencing (such as image 3 ...

Embodiment 2

[0104] Two sgRNA sequences were designed for Ntab3, 4, and 5 genes, sgRNA1: agtgtttggaaaaccctagg; sgRNA2: tggagtgtttggaaaaccct: sgRNA3: gcacttgaaaccctagccct. then follow Figure 5 Target site gene sequences for synthetic mutations of these 2 genes are shown. Using M13 as a primer, the pUC57-Kan plasmid containing the synthetic gene was used as a template to amplify the synthetic gene fragment by PCR under the action of high-fidelity DNA polymerase ( Image 6 left arrow). After the amplified gene fragment was digested with Bsa I, it was subjected to electrophoresis ( Image 6 Arrow on the right), and the recovery after cutting the gel is the synthetic gene sequence with linker. Then the pORE-CRISPR / Cas9 vector is also digested with Bsa I (such as figure 2 Black arrow), linearized cohesive ends were obtained after electrophoresis and gel recovery. The knockout vector for knocking out these two genes is constructed by ligating the synthetic gene sequence and the linearized ...

Embodiment 3

[0106] Two sgRNA sequences were designed for Ntab6 and 7 genes, sgRNA1: aacattaggaggaaaacgca; sgRNA2: gacattagggaaaacgca. then follow Figure 10 Target site gene sequences for synthetic mutations of these 2 genes are shown. Using M13 as a primer, the pUC57-Kan plasmid containing the synthetic gene was used as a template to amplify the synthetic gene fragment by PCR under the action of high-fidelity DNA polymerase ( Figure 11 left arrow). The amplified gene fragments were digested with Bsa I, electrophoresed and gel-cut, and recovered as synthetic gene sequences with adapters ( Figure 11 right arrow). Then the pORE-CRISPR / Cas9 vector is also digested with Bsa I (such as figure 2 .Black arrow), the linearized cohesive ends were obtained after electrophoresis and gel cutting recovery. The knockout vector for knocking out these two genes is constructed by ligating the synthetic gene sequence and the linearized vector using T4 ligase. After the vector is transformed into A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a synthetic gene as well as a method and application for establishing a tobacco multi-gene site-directed mutation vector. A sequence of the synthetic gene is one or multiple gene repeated sequence synthesized in a nucleotide sequence of tRNA+sgRNA+gRNA. The synthesized gene is connected into a pUC57-Kan escherichia coli clone antibody. The synthetic gene sequence is obtained by augmentation in two ways. The established vector is used for transforming the tobacco, and a transgenic tobacco plant with the multi-gene being successively knocked out is selected by virtue of sequencing. The synthetic gene is suitable for simultaneously causing the site-directed mutation and application of multiple target genes in one transgenic tobacco, so that a rapid and simple method isprovided for researching the interaction of multiple genes in the tobacco.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a synthetic gene and its method and application for constructing a tobacco multi-gene site-directed mutation carrier. Background technique [0002] Multigene mutants are of great significance in the study of basic plant functions and crop breeding. The traditional method of obtaining multiple mutants is to complete by crossing each other and segregating offspring between single mutants. However, this method has the following problems: 1. The site of gene mutation is random, and single mutants at the desired gene site cannot be obtained; 2. Multiple mutants are obtained through hybridization and recombination. If there is a close linkage between several genes , it is almost impossible to obtain multiple mutants; 3. The whole process is time-consuming and labor-intensive. [0003] CRISPR-Cas9 is a simple, efficient and widely used tool for genome editing. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82C12N15/66A01H5/00A01H6/82
CPCC12N15/113C12N15/66C12N15/8201C12N15/8241C12N2310/10C12N2810/10
Inventor姚恒高军平白戈谢贺杨大海肖炳光李永平张谊寒
OwnerYUNNAN ACAD OF TOBACCO AGRI SCI