Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer and method for detecting gene polymorphism of ethanol dehydrogenase-1B ADH1B and acetaldehyde dehydrogenase ALDH2

A technology of alcohol dehydrogenase and acetaldehyde dehydrogenase, which is applied in the fields of life science and biology, can solve the problems of limited ADH and ALDH content, inability to metabolize alcohol in time, and inability to sober up in time, and achieves low cost, high sensitivity, and easy operation. simple effect

Inactive Publication Date: 2018-09-14
杭州艾迪康医学检验中心有限公司
View PDF8 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the content of ADH and ALDH in the human body is limited. When drinking a lot of alcohol, it cannot metabolize a large amount of alcohol in time, causing drunkenness
In addition, the ADH and ALDH genes are polymorphic, and individual differences are large, resulting in some people who want to drink but cannot drink, and those who are drunk cannot sober up in time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and method for detecting gene polymorphism of ethanol dehydrogenase-1B ADH1B and acetaldehyde dehydrogenase ALDH2
  • Primer and method for detecting gene polymorphism of ethanol dehydrogenase-1B ADH1B and acetaldehyde dehydrogenase ALDH2
  • Primer and method for detecting gene polymorphism of ethanol dehydrogenase-1B ADH1B and acetaldehyde dehydrogenase ALDH2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Primers for the detection of alcohol dehydrogenase ADH1B and alcohol deacetaldehyde dehydrogenase ALDH2 polymorphic sites, including: amplifying positive, Reverse primer; the base sequence of the extended primer is:

[0056] ADH1B-F

TGTAAAACGACGGCCAGTGGAATAGTAGGGATTAGTAGC

ADH1B-R

AACAGCTATGACCATGCTCCTGAAGTCCTGGCT

ALDH2-F

TGTAAAACGACGGCCAGTCATAACCCCCAAGAGTGATTTC

ALDH2-R

AACAGCTATGACCATGAGAGCAGAGGCTGGGTCTTTAC

[0057] The primers also include sequencing primers, the base sequence of which is

[0058] M13F: TGTAAAACGACGGCCAGT

[0059] M13R: AACAGCTATGACCATG

[0060] In the detection, first use the above forward and reverse primers to amplify the DNA fragments of alcohol dehydrogenase ADH1B and alcohol deacetaldehyde dehydrogenase ALDH2 to obtain the amplified products, and then use the above sequencing primers to sequence the amplified products , to obtain the gene sequence of the amplified product.

[0061] Kits for d...

Embodiment 2

[0070] The operation process of the blood DNA extraction kit (Tiangen Biology):

[0071] (1) Genomic DNA extracted from blood:

[0072] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed.

[0073] 2) Add 20 μl proteinase K solution and mix well.

[0074] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0075] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0076] 5) Put the solution and flocculent prec...

Embodiment 3

[0103]Three clinical whole blood samples were taken, and the polymorphisms of two genes related to alcohol metabolism, alcohol dehydrogenase ADH1B and alcohol deacetaldehyde dehydrogenase ALDH2, were detected in the two samples. The genome was extracted, reagents were prepared and tested according to the method described in Example 2. Add 2 μl of each sample to the detection system PCR reaction solution. At the same time, make positive, negative, and blank controls. Detect with common PCR instrument, the time is 160 minutes.

[0104]

[0105] It can be seen from the detection results that the primers of the present invention can detect alcohol dehydrogenase ADH1B and alcohol deacetaldehyde dehydrogenase ALDH2, and the sequencing results are completely accurate. The primers of the invention can accurately amplify the genes of alcohol dehydrogenase ADH1B and alcohol deacetaldehyde dehydrogenase ALDH2, no matter they are wild type or mutant type. The detection of positive s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method, primer and detection kit for polymorphism detection of two genes of ethanol dehydrogenase ADH1B and acetaldehyde dehydrogenase ALDH2 which are relative to alcohol metabolism. Both the primer and the detection kit comprise forward and reserve primers amplifying polymorphism sites of the ethanol dehydrogenase ADH1B and the acetaldehyde dehydrogenase ALDH2 and sequencing primers. According to the method, primer and detection kit for polymorphism detection of the two genes of the ethanol dehydrogenase ADH1B and the acetaldehyde dehydrogenase ALDH2 which are relative to alcohol metabolism, a Sanger sequencing method is adopted, and the primer is used for fast detecting mutation situations of the polymorphism sites of the ethanol dehydrogenase ADH1B and acetaldehyde dehydrogenase ALDH2.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, in particular to primers and methods for detecting polymorphisms of alcohol dehydrogenase ADH1B and alcohol deacetaldehyde dehydrogenase ALDH2 Background technique [0002] Alcohol dehydrogenase ADH and alcohol deacetaldehyde dehydrogenase ALDH2 then produce oxidation, oxidize ethanol into acetaldehyde and acetic acid, undertake most of the tasks of alcohol metabolism, and are the most important alcohol metabolism in the human body. [0003] The first step of the ADH system is mainly to generate acetaldehyde from ethanol under the action of ADH, and 80% of alcohol oxidation is carried out in the liver through this pathway; the second step, acetaldehyde is generated under the action of ALDH, which has no toxic effects on the body Acetic acid, the concentration of acetaldehyde in the blood after drinking is mainly determined by ALDH. ADH and ALDH in liver cells play an important role ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6869C12N15/11
CPCC12Q1/6869C12Q1/6883C12Q2600/156C12Q2531/113C12Q2535/101
Inventor 王淑一吴鹏飞孙翠莲
Owner 杭州艾迪康医学检验中心有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More