Primer and method for detecting gene polymorphism of ethanol dehydrogenase-1B ADH1B and acetaldehyde dehydrogenase ALDH2
A technology of alcohol dehydrogenase and acetaldehyde dehydrogenase, which is applied in the fields of life science and biology, can solve the problems of limited ADH and ALDH content, inability to metabolize alcohol in time, and inability to sober up in time, and achieves low cost, high sensitivity, and easy operation. simple effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Primers for the detection of alcohol dehydrogenase ADH1B and alcohol deacetaldehyde dehydrogenase ALDH2 polymorphic sites, including: amplifying positive, Reverse primer; the base sequence of the extended primer is:
[0056] ADH1B-F
TGTAAAACGACGGCCAGTGGAATAGTAGGGATTAGTAGC
ADH1B-R
AACAGCTATGACCATGCTCCTGAAGTCCTGGCT
ALDH2-F
TGTAAAACGACGGCCAGTCATAACCCCCAAGAGTGATTTC
ALDH2-R
AACAGCTATGACCATGAGAGCAGAGGCTGGGTCTTTAC
[0057] The primers also include sequencing primers, the base sequence of which is
[0058] M13F: TGTAAAACGACGGCCAGT
[0059] M13R: AACAGCTATGACCATG
[0060] In the detection, first use the above forward and reverse primers to amplify the DNA fragments of alcohol dehydrogenase ADH1B and alcohol deacetaldehyde dehydrogenase ALDH2 to obtain the amplified products, and then use the above sequencing primers to sequence the amplified products , to obtain the gene sequence of the amplified product.
[0061] Kits for d...
Embodiment 2
[0070] The operation process of the blood DNA extraction kit (Tiangen Biology):
[0071] (1) Genomic DNA extracted from blood:
[0072] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed.
[0073] 2) Add 20 μl proteinase K solution and mix well.
[0074] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0075] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0076] 5) Put the solution and flocculent prec...
Embodiment 3
[0103]Three clinical whole blood samples were taken, and the polymorphisms of two genes related to alcohol metabolism, alcohol dehydrogenase ADH1B and alcohol deacetaldehyde dehydrogenase ALDH2, were detected in the two samples. The genome was extracted, reagents were prepared and tested according to the method described in Example 2. Add 2 μl of each sample to the detection system PCR reaction solution. At the same time, make positive, negative, and blank controls. Detect with common PCR instrument, the time is 160 minutes.
[0104]
[0105] It can be seen from the detection results that the primers of the present invention can detect alcohol dehydrogenase ADH1B and alcohol deacetaldehyde dehydrogenase ALDH2, and the sequencing results are completely accurate. The primers of the invention can accurately amplify the genes of alcohol dehydrogenase ADH1B and alcohol deacetaldehyde dehydrogenase ALDH2, no matter they are wild type or mutant type. The detection of positive s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


