Anti-Ebola virus monoclonal antibody, preparation method and uses thereof

A technology of monoclonal antibody and Ebola virus, applied in the fields of immunology and molecular biology

Active Publication Date: 2018-09-25
BEIJING MABWORKS BIOTECH
View PDF9 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, objective factors such as nearly 20,000 Chinese citizens working and living in affected areas in Africa, and the large number of business and trade exchanges between China and Africa have brought huge challenges to my country's prevention and control of the Ebola epidemic.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-Ebola virus monoclonal antibody, preparation method and uses thereof
  • Anti-Ebola virus monoclonal antibody, preparation method and uses thereof
  • Anti-Ebola virus monoclonal antibody, preparation method and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0127] Example 1: Obtaining the Nucleotide Sequence of Antibody MIL77

[0128] The antibody amino acid sequence is a recombinant antibody sequence from patents WO2009 / 094755 A1 and US2004 / 0053865A1. The nucleotide sequence of the antibody MIL77 of the present invention was obtained by selecting codons with high frequency used in mammalian cells for reverse translation, rationally optimizing through bioinformatics technology, and using molecular modeling and molecular biology mutation experiments.

[0129] Wherein, the light chain nucleotide sequence of the antibody MIL77-1 is:

[0130] gacatccagatgactcagtctccagcctccctatctgtatctgtgggagaaactgtctccatcacatgtcgagcaag tgagaatatttcagtagtttagcatggtatcagcagaaacagggaaaatctcctcagctcctggtctattctgcaa caatcttagcagatggtgtgccatcaaggttcagtggcagtggatcaggcactcagtattccctcaagatcaacagc ctgcagtctgaagattttggggacttattactgtcaacatttttggggtactccgtacacgttcggagggggggaccaa gctggaaataaaa cgtacggtggctgcaccatctgtcttcatcttcccgccatctgatgagcagttgaaatc...

Embodiment 2

[0153] Example 2: Cloning of Antibody MIL77-1, MIL77-2 and MIL77-3 Genes

[0154] 1. Experimental materials

[0155] Phusion polymerase, Taq DNA polymerase, restriction endonuclease, pGEM-T-easy vector, and Pyrobest DNA polymerase are all products of NEB Company;

[0156] dNTP and DNA Marker standards are TaKaRa products;

[0157] The DNA recovery kit is a product of Qiagen;

[0158] Trans2-Blue competent state is the product of Quanshijin Company;

[0159]Small-scale plasmid kit (DP107-02) is a product of Tiangen Biochemical Company;

[0160] The large extraction plasmid kit (DP117) is a product of Tiangen Biochemical Company;

[0161] OPD is a product of Sigma;

[0162] FITC-labeled goat anti-human antibody: a product of Pierce;

[0163] Primers were designed with Biosun software;

[0164] Primer synthesis (Genewiz), Genewiz Biotechnology (Beijing) Co., Ltd.;

[0165] Gene sequencing was completed by Beijing Nuosai Genome Research Center Co., Ltd.

[0166] 2. Expe...

Embodiment 3

[0193] Example 3: Preparation of MIL77-1, MIL77-2 and MIL77-3 antibodies

[0194] 1. Experimental materials

[0195] The dry powder medium commissioned by Hyclone is formulated for host cell acclimatization, cell line screening and antibody preparation to cultivate cells. During cell screening, methionine sulfoximine (Methionine sulfoximine) purchased from Sigma is added to the prepared medium. , MSX), using trypan blue dry powder purchased from sigma to prepare a solution for cell counting.

[0196] 2. Experimental methods and results

[0197] 2.1 Construction of antibody eukaryotic expression vector

[0198] Select the expression vector pTGS-FRT-DHFR (patent authorization number: ZL200510064335.0) obtained by the applicant, remove the hygromycin selection tag, and add GS (glutamine synthetase, glutamine synthetase) through the PshA1 and Xho1 restriction sites Expression cassette, as a selection marker; wherein GS cDNA was obtained by RT-PCR from the cell line CHO expres...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Equilibrium dissociation constantaaaaaaaaaa
Equilibrium dissociation constantaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of immunology and molecular biology, and relates to an anti-Ebola virus monoclonal antibody, a preparation method and uses thereof, specifically to an anti-Ebola virus monoclonal antibody or an antigen-binding part thereof, wherein the amino acid sequences of the light chain variable region and the heavy chain variable region comprise one group selected from thefollowing groups (1)-(3): the group (1): the amino acid sequence of the light chain variable region is represented by SEQ ID NO:4, and the amino acid sequence of the heavy chain variable region is represented by SEQ ID NO:6; the group (2): the amino acid sequence of the light chain variable region is represented by SEQ ID NO:10, and the amino acid sequence of the heavy chain variable region is represented by SEQ ID NO:12; and the group (3): the amino acid sequence of the light chain variable region is represented by SEQ ID NO:16, and the amino acid sequence of the heavy chain variable region is represented by SEQ ID NO:18. According to the present invention, the anti-Ebola virus monoclonal antibody has advantages of enhanced ADCC activity, good antigen-binding activity and good virus-neutralizing activity.

Description

technical field [0001] The invention belongs to the fields of immunology and molecular biology, and relates to an anti-Ebola virus monoclonal antibody, its preparation method and application. Background technique [0002] Ebola virus, also translated as Ebola virus, is a very rare virus. After it was discovered in the Ebola River area in southern Sudan and Congo (Kinshasa) (formerly known as Zaire) in 1976, it aroused medical attention. The widespread attention and attention that "Ebola" got from this. Ebola virus is a severe infectious disease virus that can cause Ebola hemorrhagic fever in humans and primates. The biosafety level is level 4 (level 3 for AIDS and level 3 for SARS. The higher the level, the better the protection. Strict); Ebola virus is mainly transmitted through the patient's blood, saliva, sweat and secretions, etc. The incubation period of the virus can reach 2 to 21 days, but usually only about 5 to 10 days; % to 90%; the main cause of death was stroke...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/10C12N15/13A61K39/42A61P31/14
CPCC07K16/10C07K2317/92C07K2317/732C12N15/85C12N5/0682A61P31/14C07K2317/565C07K2317/56C07K2317/51C07K2317/515C07K2317/14C07K2317/76C12N2800/107C12N2510/02
Inventor李锋张伯彦叶培刘慧芳刘旭谢波赵健
OwnerBEIJING MABWORKS BIOTECH